ID: 935691757

View in Genome Browser
Species Human (GRCh38)
Location 2:105738221-105738243
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935691751_935691757 29 Left 935691751 2:105738169-105738191 CCACCGCTCCTGCTAGAAGTCTT No data
Right 935691757 2:105738221-105738243 ATGACTAGGCTGTAAGTAACTGG No data
935691754_935691757 6 Left 935691754 2:105738192-105738214 CCCTTTTAAAACATGCAAGTAAG No data
Right 935691757 2:105738221-105738243 ATGACTAGGCTGTAAGTAACTGG No data
935691752_935691757 26 Left 935691752 2:105738172-105738194 CCGCTCCTGCTAGAAGTCTTCCC No data
Right 935691757 2:105738221-105738243 ATGACTAGGCTGTAAGTAACTGG No data
935691753_935691757 21 Left 935691753 2:105738177-105738199 CCTGCTAGAAGTCTTCCCTTTTA No data
Right 935691757 2:105738221-105738243 ATGACTAGGCTGTAAGTAACTGG No data
935691755_935691757 5 Left 935691755 2:105738193-105738215 CCTTTTAAAACATGCAAGTAAGC No data
Right 935691757 2:105738221-105738243 ATGACTAGGCTGTAAGTAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type