ID: 935691758

View in Genome Browser
Species Human (GRCh38)
Location 2:105738237-105738259
Sequence TAACTGGAGCCCTCACTCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935691755_935691758 21 Left 935691755 2:105738193-105738215 CCTTTTAAAACATGCAAGTAAGC No data
Right 935691758 2:105738237-105738259 TAACTGGAGCCCTCACTCAATGG No data
935691754_935691758 22 Left 935691754 2:105738192-105738214 CCCTTTTAAAACATGCAAGTAAG No data
Right 935691758 2:105738237-105738259 TAACTGGAGCCCTCACTCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935691758 Original CRISPR TAACTGGAGCCCTCACTCAA TGG Intergenic