ID: 935692631

View in Genome Browser
Species Human (GRCh38)
Location 2:105744921-105744943
Sequence CCGCGCGGCCGAGCGGGCGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 585
Summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 542}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935692619_935692631 12 Left 935692619 2:105744886-105744908 CCGCCGCCGCTGCCGCGGGGATC 0: 1
1: 0
2: 4
3: 50
4: 368
Right 935692631 2:105744921-105744943 CCGCGCGGCCGAGCGGGCGGCGG 0: 1
1: 0
2: 3
3: 39
4: 542
935692620_935692631 9 Left 935692620 2:105744889-105744911 CCGCCGCTGCCGCGGGGATCGTC 0: 1
1: 0
2: 0
3: 7
4: 80
Right 935692631 2:105744921-105744943 CCGCGCGGCCGAGCGGGCGGCGG 0: 1
1: 0
2: 3
3: 39
4: 542
935692617_935692631 15 Left 935692617 2:105744883-105744905 CCGCCGCCGCCGCTGCCGCGGGG 0: 2
1: 18
2: 117
3: 649
4: 3264
Right 935692631 2:105744921-105744943 CCGCGCGGCCGAGCGGGCGGCGG 0: 1
1: 0
2: 3
3: 39
4: 542
935692624_935692631 0 Left 935692624 2:105744898-105744920 CCGCGGGGATCGTCAGGCCGGAG 0: 1
1: 0
2: 0
3: 2
4: 123
Right 935692631 2:105744921-105744943 CCGCGCGGCCGAGCGGGCGGCGG 0: 1
1: 0
2: 3
3: 39
4: 542
935692613_935692631 21 Left 935692613 2:105744877-105744899 CCGCCGCCGCCGCCGCCGCTGCC 0: 63
1: 1208
2: 1776
3: 3026
4: 6001
Right 935692631 2:105744921-105744943 CCGCGCGGCCGAGCGGGCGGCGG 0: 1
1: 0
2: 3
3: 39
4: 542
935692610_935692631 30 Left 935692610 2:105744868-105744890 CCGCCGCCGCCGCCGCCGCCGCC 0: 1025
1: 1397
2: 2293
3: 4170
4: 7329
Right 935692631 2:105744921-105744943 CCGCGCGGCCGAGCGGGCGGCGG 0: 1
1: 0
2: 3
3: 39
4: 542
935692611_935692631 27 Left 935692611 2:105744871-105744893 CCGCCGCCGCCGCCGCCGCCGCC 0: 1025
1: 1397
2: 2293
3: 4170
4: 7329
Right 935692631 2:105744921-105744943 CCGCGCGGCCGAGCGGGCGGCGG 0: 1
1: 0
2: 3
3: 39
4: 542
935692612_935692631 24 Left 935692612 2:105744874-105744896 CCGCCGCCGCCGCCGCCGCCGCT 0: 99
1: 1353
2: 1777
3: 3042
4: 5934
Right 935692631 2:105744921-105744943 CCGCGCGGCCGAGCGGGCGGCGG 0: 1
1: 0
2: 3
3: 39
4: 542
935692621_935692631 6 Left 935692621 2:105744892-105744914 CCGCTGCCGCGGGGATCGTCAGG 0: 1
1: 0
2: 0
3: 1
4: 90
Right 935692631 2:105744921-105744943 CCGCGCGGCCGAGCGGGCGGCGG 0: 1
1: 0
2: 3
3: 39
4: 542
935692614_935692631 18 Left 935692614 2:105744880-105744902 CCGCCGCCGCCGCCGCTGCCGCG 0: 4
1: 176
2: 1588
3: 2364
4: 4373
Right 935692631 2:105744921-105744943 CCGCGCGGCCGAGCGGGCGGCGG 0: 1
1: 0
2: 3
3: 39
4: 542

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935692631 Original CRISPR CCGCGCGGCCGAGCGGGCGG CGG Exonic