ID: 935694602

View in Genome Browser
Species Human (GRCh38)
Location 2:105760583-105760605
Sequence CTCTTGGATCTCTCCATCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 380
Summary {0: 1, 1: 0, 2: 5, 3: 49, 4: 325}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935694596_935694602 2 Left 935694596 2:105760558-105760580 CCACTTCTCCCACAGTTTTGACC 0: 1
1: 0
2: 2
3: 18
4: 171
Right 935694602 2:105760583-105760605 CTCTTGGATCTCTCCATCTGAGG 0: 1
1: 0
2: 5
3: 49
4: 325
935694598_935694602 -7 Left 935694598 2:105760567-105760589 CCACAGTTTTGACCACCTCTTGG 0: 1
1: 0
2: 1
3: 14
4: 134
Right 935694602 2:105760583-105760605 CTCTTGGATCTCTCCATCTGAGG 0: 1
1: 0
2: 5
3: 49
4: 325
935694592_935694602 27 Left 935694592 2:105760533-105760555 CCTAGCTCTAAGGCTCCCCGTGT 0: 1
1: 0
2: 0
3: 5
4: 102
Right 935694602 2:105760583-105760605 CTCTTGGATCTCTCCATCTGAGG 0: 1
1: 0
2: 5
3: 49
4: 325
935694597_935694602 -6 Left 935694597 2:105760566-105760588 CCCACAGTTTTGACCACCTCTTG 0: 1
1: 0
2: 1
3: 8
4: 132
Right 935694602 2:105760583-105760605 CTCTTGGATCTCTCCATCTGAGG 0: 1
1: 0
2: 5
3: 49
4: 325
935694594_935694602 11 Left 935694594 2:105760549-105760571 CCCGTGTAACCACTTCTCCCACA 0: 1
1: 0
2: 2
3: 18
4: 171
Right 935694602 2:105760583-105760605 CTCTTGGATCTCTCCATCTGAGG 0: 1
1: 0
2: 5
3: 49
4: 325
935694593_935694602 12 Left 935694593 2:105760548-105760570 CCCCGTGTAACCACTTCTCCCAC 0: 1
1: 0
2: 1
3: 4
4: 178
Right 935694602 2:105760583-105760605 CTCTTGGATCTCTCCATCTGAGG 0: 1
1: 0
2: 5
3: 49
4: 325
935694595_935694602 10 Left 935694595 2:105760550-105760572 CCGTGTAACCACTTCTCCCACAG 0: 1
1: 0
2: 2
3: 16
4: 242
Right 935694602 2:105760583-105760605 CTCTTGGATCTCTCCATCTGAGG 0: 1
1: 0
2: 5
3: 49
4: 325

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935694602 Original CRISPR CTCTTGGATCTCTCCATCTG AGG Intronic
901491400 1:9598127-9598149 TTCTTGGAGCTCTGCATCTGGGG + Intronic
901924396 1:12556789-12556811 CACTTGAATCTCTCCCTCTTTGG - Intergenic
902152495 1:14455052-14455074 TTCTTGGATCTCTTTCTCTGGGG - Intergenic
902556857 1:17252003-17252025 CTGTTGGGCCTCTCTATCTGTGG + Intronic
903362868 1:22787980-22788002 CTCTTGGCTCTCTCACTCTGGGG - Intronic
904320857 1:29697141-29697163 CTCCTGGACCTTTCCGTCTGGGG + Intergenic
904332312 1:29768040-29768062 CTGTGGGAGCTCTCCATCCGTGG - Intergenic
906010703 1:42522250-42522272 CAGTTGGCTCTCTGCATCTGTGG - Intronic
906373328 1:45273216-45273238 CTCTTGGATCACTCATTCAGGGG - Intronic
906665975 1:47622317-47622339 GTCTTCCATCTCCCCATCTGTGG + Intergenic
907183369 1:52590080-52590102 AGCTTGGATCTCTCCACCAGTGG + Intergenic
907285923 1:53379521-53379543 CTCTTGGATTTCTTCAGCTGAGG + Intergenic
907498176 1:54859125-54859147 CTCTTGGATCACTTGCTCTGGGG + Intronic
908363067 1:63389208-63389230 CTCTTAGATTTGTCCATTTGAGG + Intronic
908599820 1:65726548-65726570 CTCCTGGATCTCTTTAACTGTGG - Intergenic
909414827 1:75394117-75394139 CTCTCTGATCTCTCCTTCTCTGG - Intronic
909638929 1:77850213-77850235 CTCTTGGGTCACTCCCTCTGCGG - Intronic
910823998 1:91386222-91386244 CTCTTAGATCTCTCACTCTGTGG + Intronic
911036890 1:93559887-93559909 GTCTTGGATCACTCAATCTGGGG - Intergenic
912257680 1:108077840-108077862 ATCCAGGATCTCTCCATGTGAGG + Intergenic
912331583 1:108825000-108825022 CTCTTGGATCACTTGCTCTGGGG + Intronic
912416500 1:109511724-109511746 CTCTTGCATCTCTTGCTCTGAGG - Intergenic
913433002 1:118815984-118816006 CTGTTGGTTCTGTTCATCTGTGG - Intergenic
913608944 1:120492206-120492228 GCCTTGGATATCTCCAGCTGAGG + Intergenic
916317064 1:163460933-163460955 GTCTTGGATCACTCACTCTGGGG - Intergenic
917663975 1:177206013-177206035 CTCTTGGCTCACTCTCTCTGGGG + Intronic
918045633 1:180939345-180939367 CTCCTGGACATCTCCATCAGGGG + Intronic
919282315 1:195507119-195507141 CCCTTGGATCAGTCCCTCTGGGG + Intergenic
919451392 1:197775889-197775911 CTCTTGCGTCACTCCAGCTGTGG + Intergenic
919758986 1:201085177-201085199 CTCTTGGAACTCTCAGTCTCTGG - Intronic
920693402 1:208163921-208163943 CTCTTGGATGTCAGCATGTGGGG + Intronic
920783286 1:209015341-209015363 CTCTTGGATCACTCACTCTGGGG - Intergenic
922177681 1:223209318-223209340 TTCTTAGATCTCTCCAACTTTGG - Intergenic
922861624 1:228822903-228822925 CTATTGGTTCTGTCCCTCTGGGG - Intergenic
923396691 1:233572868-233572890 CTCTTGGATCTTTCTCTCTAAGG + Intergenic
1062814817 10:491681-491703 GTGTTTGATCTCTCCATCTGCGG - Intronic
1063063178 10:2578812-2578834 CTGTTGAGTCTCTCCATCAGTGG - Intergenic
1063884964 10:10567987-10568009 CTCCTGGAACTCTCACTCTGGGG + Intergenic
1066563130 10:36691834-36691856 TTCCTGGAACTCTCTATCTGAGG + Intergenic
1067021045 10:42798275-42798297 TTCCTGGCTCTCTTCATCTGTGG + Intronic
1067900951 10:50241026-50241048 CTCTTGGGTCACTCACTCTGAGG + Intronic
1069738246 10:70671793-70671815 CTCTTGGTTCTTTCCACCTTGGG + Intergenic
1071129954 10:82378885-82378907 CTCTTGCTTCTCTCCTTCTATGG + Intronic
1071564859 10:86666559-86666581 CTCTTGGGACTCTCACTCTGAGG + Intronic
1071593642 10:86901045-86901067 CTCTGGGATCACTCACTCTGGGG + Intronic
1073252315 10:102128516-102128538 CTTTTGGATCTCTTGCTCTGGGG - Intergenic
1073571260 10:104582865-104582887 CTCTCGGGTCTCCCCTTCTGGGG - Intergenic
1073629053 10:105129822-105129844 CTCTTGGAGATCTCTATCTGTGG + Intronic
1074224077 10:111466596-111466618 CTCTTGGATCACTCACTCTGGGG + Intergenic
1074456264 10:113597991-113598013 TTCTTTGCACTCTCCATCTGTGG + Exonic
1075115761 10:119626148-119626170 CTCTTGAATCACTGCCTCTGAGG - Intergenic
1075781558 10:125020691-125020713 CCCTTGGAGCTCTCCAGATGCGG + Intronic
1077941581 11:6848829-6848851 CTGGTGGATCTATCCTTCTGGGG - Intergenic
1078628699 11:12982261-12982283 CTCTTGGGTCACTCTCTCTGGGG - Intergenic
1079246347 11:18755090-18755112 CTCTTGGATCACTCACTCTGTGG + Intronic
1080873387 11:36256508-36256530 CTCTTGGATCACTCACTCTGAGG - Intergenic
1083493247 11:63028387-63028409 CTCTCCGATCTCTGCCTCTGTGG + Intergenic
1083691762 11:64413589-64413611 CAGTTGGACCTCTCCATTTGGGG - Intergenic
1083818669 11:65152999-65153021 CTCTTGGATCTCTTGCTCTGGGG + Intergenic
1084311819 11:68321417-68321439 CCCTTTGATCTCTTGATCTGGGG + Intronic
1084859511 11:72009169-72009191 GTTTTGGCTTTCTCCATCTGTGG + Exonic
1085430120 11:76440816-76440838 CTCTTGGATCACTTGCTCTGGGG + Intergenic
1087174086 11:95080215-95080237 CTCTTGTATCTCTCCTTTTAAGG - Intergenic
1089063048 11:115641944-115641966 CTCTTTGATCTCTACATCCCTGG - Intergenic
1089133345 11:116229591-116229613 GTCTTGCTTCTCTCCATCAGGGG - Intergenic
1089192721 11:116665466-116665488 CTCTTTGCTTTGTCCATCTGGGG - Intergenic
1089212247 11:116813392-116813414 CTCTTGGATCACTCATTCTGAGG - Intergenic
1089446205 11:118554413-118554435 CTCTTGGCCCTCTCCAGCTGGGG + Intronic
1089642353 11:119856205-119856227 CTCTTGGATTGCTCGCTCTGGGG - Intergenic
1090338551 11:125993698-125993720 CTCTTGCATCTCTCCCTTTCTGG - Intronic
1090463033 11:126908843-126908865 CTCTTGGGTATCACAATCTGCGG + Intronic
1092125557 12:6072783-6072805 CTCTTGACTCCCTTCATCTGTGG - Intronic
1092251016 12:6896946-6896968 CTCTTGGATCACTTGCTCTGGGG + Intronic
1092365847 12:7876325-7876347 CTCCTGGATTTCTCCTTGTGAGG + Intronic
1095142758 12:38686823-38686845 CTCTGGGATCACTCAATCTGGGG - Intronic
1098115248 12:67169074-67169096 CTCTTTGCTGTCTCCATGTGAGG - Intergenic
1098845221 12:75526706-75526728 CTCTGGGATCACTCATTCTGGGG + Intergenic
1099589094 12:84563445-84563467 CACTTGAATCTCAACATCTGTGG + Intergenic
1100200268 12:92290638-92290660 CTCTTGGATTACTCTCTCTGGGG + Intergenic
1101912129 12:108867905-108867927 CTCTTGGATTTCTCATTCTGGGG + Intronic
1103127323 12:118435279-118435301 CTCTTGTGTCTCTCTACCTGAGG - Intergenic
1103184023 12:118940607-118940629 CTCTTGGATCACTTAGTCTGGGG - Intergenic
1104496984 12:129250085-129250107 CTCCTTGATGTCTCCATTTGGGG - Intronic
1105320729 13:19318974-19318996 CTGTTGGCTCTTTCCATCTAGGG - Intergenic
1107175587 13:37394893-37394915 CCCTTGGTGCTCTCCAGCTGGGG + Intergenic
1108238686 13:48437699-48437721 CTCTAGGATCTCTTCCACTGGGG - Intronic
1109304014 13:60618893-60618915 CTCATGGATCTCTCTCTCTCTGG - Intergenic
1109630005 13:65033432-65033454 CTCTTGCATCTCCACATTTGTGG - Intergenic
1110942751 13:81370511-81370533 CACTTGTATCTCACCTTCTGAGG + Intergenic
1112243407 13:97704663-97704685 CTTTTGGATCACTCACTCTGAGG - Intergenic
1112253040 13:97801426-97801448 CTCTTGGATCACTCCCTCTGGGG + Intergenic
1116724107 14:48539656-48539678 CTCTTCAATCTCTCCATCAGGGG - Intergenic
1117013666 14:51496099-51496121 CTCTTGGATCACTCACTCTGAGG + Intronic
1117318259 14:54596004-54596026 CTAGTGGATCTCTTCCTCTGTGG + Intronic
1117448676 14:55829550-55829572 CTCTCAGAACTGTCCATCTGGGG + Intergenic
1118970281 14:70630832-70630854 CTCTTAGATCTCTTGTTCTGGGG + Intergenic
1119060637 14:71470627-71470649 CTCTGGGTTCTCATCATCTGGGG + Intronic
1119635876 14:76273098-76273120 CTCTTGTATCTCTTCTTCTAAGG + Intergenic
1119806598 14:77486319-77486341 CTCTTTGACCTCCCCTTCTGCGG + Intronic
1120251316 14:82064126-82064148 CTCTTGAAACTCTCCAACTCTGG - Intergenic
1120748721 14:88177542-88177564 CTCTAGGAACTCTCGATGTGGGG + Intergenic
1122406800 14:101505632-101505654 CTCTTGGATCTCCCCAGGGGTGG - Intergenic
1123231577 15:17124679-17124701 CTTTTGTATCTCTCTTTCTGCGG + Intergenic
1123240300 15:17275745-17275767 CTTTTGTATCTCTCTTTCTGCGG + Intergenic
1123252263 15:17483663-17483685 CTTTTGTATCTCTCTTTCTGCGG + Intergenic
1123804812 15:23860236-23860258 TTCTAAGATCTGTCCATCTGGGG + Intergenic
1124456727 15:29849968-29849990 CTCTTGGATCACTCGCTCTGGGG + Intronic
1124616641 15:31247009-31247031 CTCCTGGCTCTGCCCATCTGTGG + Intergenic
1125024141 15:35013505-35013527 CTAATGGGTCACTCCATCTGGGG + Intergenic
1125337017 15:38636710-38636732 GTCTTGGATCACTCAGTCTGGGG + Intergenic
1126099469 15:45111024-45111046 CCCATGGAGCTCCCCATCTGTGG - Intronic
1126104058 15:45136013-45136035 CCCATGGAGCTCCCCATCTGTGG + Intronic
1126741561 15:51781658-51781680 GTCTTGGATCACTCGCTCTGGGG - Intronic
1128079674 15:64848891-64848913 CTCTTGGGTCTCTGTATATGGGG + Intronic
1128686450 15:69689848-69689870 CTCTTGGATTGCTCCCTCTGAGG + Intergenic
1130033141 15:80333797-80333819 CTCTTGGATGTCTCCACATCAGG + Intergenic
1133908404 16:10042324-10042346 CTTTTGGATCACTCACTCTGAGG + Intronic
1134628621 16:15740881-15740903 CTCTCAGATCACTCCTTCTGGGG + Intronic
1135163173 16:20115578-20115600 CTCTTGGATCACTCACTCTGGGG - Intergenic
1135914654 16:26594908-26594930 CTCCTGGATCTCTAAGTCTGGGG + Intergenic
1136488840 16:30591553-30591575 CTTGTGCATCTCACCATCTGAGG - Intergenic
1136571302 16:31098774-31098796 CTCTTAGATCACTCATTCTGGGG - Intergenic
1137538210 16:49343418-49343440 CTCTTGGATCACTCGCTCTGGGG + Intergenic
1137667596 16:50260826-50260848 CCTTTGGATCTCTCCCTCTAGGG - Intronic
1138170516 16:54844949-54844971 CTCTTGGATCACTCATTTTGGGG - Intergenic
1143277611 17:5723428-5723450 CTCTTACATCTCTCCTTATGTGG + Intergenic
1143407617 17:6687996-6688018 CTCTAGGCTCTCTCAGTCTGTGG - Intronic
1143409137 17:6697988-6698010 CTCATGGACCTCCCCACCTGAGG - Intronic
1143505892 17:7364970-7364992 CTCTTGGATCACTCCCTCTGGGG - Intergenic
1143907164 17:10218161-10218183 CTCTGGGATCACTCTGTCTGAGG - Intergenic
1145759311 17:27417122-27417144 ATCTGGGAGCTCTGCATCTGTGG - Intergenic
1146951162 17:36907526-36907548 CTCTTCCAGCTCTCAATCTGGGG - Intergenic
1147442256 17:40454344-40454366 CCCCTGGATTTCACCATCTGTGG + Intronic
1148909434 17:50932794-50932816 ATCCTGGCTCTCTGCATCTGGGG - Intergenic
1149054470 17:52346560-52346582 CTCTTAGATTTGCCCATCTGAGG + Intergenic
1151902697 17:77027439-77027461 CTCTTAGATCACTCCCTTTGGGG + Intergenic
1153279044 18:3396862-3396884 CTCTGGGATCTCTCTACCTCTGG - Intergenic
1154965815 18:21355109-21355131 CTCTTGGATCACTTTCTCTGAGG - Intronic
1155258596 18:24020088-24020110 TTCTTACATCTCTGCATCTGTGG - Intronic
1155558717 18:27051459-27051481 CTTTTGGATCACTCCCTCTGGGG + Intronic
1155937433 18:31768165-31768187 CTCTTGTATCGCTCAGTCTGAGG - Intergenic
1156024183 18:32632514-32632536 CTCTTGGATGGTACCATCTGAGG + Intergenic
1156156705 18:34311691-34311713 CTCTTGGAGCTCTCTCTATGAGG + Intergenic
1158519353 18:58158252-58158274 CTTTTGGATCATTCCCTCTGGGG - Intronic
1158985834 18:62815606-62815628 CTCTAGGATCACTCCCTCTGGGG - Intronic
1159484285 18:69034131-69034153 CTCTTATTTCTCTCCTTCTGTGG + Intronic
1160288627 18:77570052-77570074 CTTTTGTATGACTCCATCTGGGG - Intergenic
1162396740 19:10421472-10421494 CTCTTGGAGCACTCCATAAGGGG + Intronic
1165149259 19:33751345-33751367 CCCTTGGATGTCTACGTCTGAGG - Intronic
1165951217 19:39474792-39474814 CTCTGGGCTGTCACCATCTGGGG - Intronic
1167144696 19:47674786-47674808 CTCTCGGATCACTCGTTCTGGGG - Intronic
1167496363 19:49821239-49821261 CTATTGGGTCCCTCAATCTGAGG - Intronic
1167741349 19:51326581-51326603 GCCTGGGATCTCTCCAGCTGGGG - Intronic
1167741415 19:51326773-51326795 CTCCAGGATCTCTCCCTCCGAGG - Exonic
1168136503 19:54355664-54355686 TCCTTGGATCCCTCCCTCTGGGG + Intronic
925671014 2:6310009-6310031 CACTAGGATTTCTCCAGCTGGGG + Intergenic
927183779 2:20467716-20467738 CTCTTGGGCCTCTGCAGCTGTGG + Intergenic
927947592 2:27146403-27146425 CTCTTGGATCGCTCACTCTGGGG - Intergenic
928279367 2:29930553-29930575 CTCTTGGATCACTTGCTCTGAGG + Intergenic
928712146 2:34019165-34019187 CCCTTGGGTCTTTCCATCTCTGG + Intergenic
930365838 2:50438297-50438319 CTCCTAGTTTTCTCCATCTGGGG - Intronic
930627086 2:53709884-53709906 CTCTTAGACCTCTTCCTCTGAGG + Intronic
931893892 2:66707191-66707213 CTTTTGCATCTCTCACTCTGGGG + Intergenic
932559402 2:72854173-72854195 CTCTTGGTTTTCTCAATCTGTGG + Intergenic
933657184 2:84898698-84898720 CCCTTGGATTTCTCATTCTGGGG - Intronic
934070039 2:88375350-88375372 CTCTTGGATCACTCCTTCTGGGG - Intergenic
934123072 2:88858384-88858406 CTCTTGGAAATCCCCCTCTGGGG + Intergenic
935694602 2:105760583-105760605 CTCTTGGATCTCTCCATCTGAGG + Intronic
936350306 2:111707293-111707315 CTCCTGGATTGCTCAATCTGTGG + Intergenic
937176539 2:119942202-119942224 CTGTTGAATCTCTACTTCTGGGG - Intronic
937269750 2:120641520-120641542 CTGCTGGATCACTCCCTCTGGGG + Intergenic
937422030 2:121765305-121765327 GTCTATGATCTCTCCATCCGGGG + Exonic
937629715 2:124087381-124087403 TTCTTAGATTTCTTCATCTGAGG + Intronic
938680852 2:133688553-133688575 CTCATGTATTTCTCCATGTGTGG - Intergenic
938759041 2:134407121-134407143 CTCTTAGATCTCACCAGCTAGGG + Intronic
940234309 2:151493375-151493397 CGCTTAGCTCTCTCCATCTCTGG + Exonic
941841460 2:170089062-170089084 CTCTTGGGTCACTTCTTCTGTGG - Intergenic
942249309 2:174034100-174034122 CCCCTGGATGTCTCCATTTGGGG - Intergenic
942847356 2:180442712-180442734 CTCTTGGATCACTCAGTTTGAGG + Intergenic
942989642 2:182184130-182184152 CTCTCTGTTCTCTCCTTCTGAGG - Intronic
943076894 2:183206718-183206740 CTTTTGGATCTCTTGCTCTGTGG + Intergenic
944744783 2:202644482-202644504 CTCATTGATCTCTACATCTGTGG + Intronic
944970457 2:204986518-204986540 TTGTTGGATGTCACCATCTGAGG - Intronic
945117474 2:206422128-206422150 CTCTTGGAACATTCCATTTGTGG - Intergenic
945419145 2:209613563-209613585 CTCCTTGATCCATCCATCTGGGG - Intronic
945805046 2:214479874-214479896 CACTTGGCCCTCTCTATCTGTGG + Intronic
946098972 2:217302462-217302484 CTGGTGGTTCTGTCCATCTGTGG - Intronic
946186234 2:217982079-217982101 CTCTTGGATCACTTGCTCTGGGG + Intronic
946403468 2:219480898-219480920 CGCTGGGCTCTCTCCATCTAGGG - Intronic
946605589 2:221400661-221400683 TTCTTGGATCACTCACTCTGGGG - Intergenic
946724897 2:222652523-222652545 CTCTCGGACCTCTCCATCTGGGG + Intronic
948285922 2:236785161-236785183 CTCTTGGATCACTGGCTCTGGGG + Intergenic
948739537 2:240033686-240033708 CACTTTGATCTCTGCATCTCAGG + Intergenic
1168834531 20:869334-869356 CTCTAGGATACCTGCATCTGCGG - Intergenic
1168899110 20:1345201-1345223 CTTTTGGATCACTGGATCTGGGG + Intronic
1169087916 20:2838838-2838860 CTCTGGGATCTCTCCAGGTTGGG - Exonic
1169419196 20:5445731-5445753 CTCTTAGATCTCTCTCTCTGCGG - Intergenic
1170082301 20:12490538-12490560 CTCTTGAATCACTCACTCTGTGG + Intergenic
1170193716 20:13669330-13669352 CTCTGAGATCCCTCAATCTGTGG + Intergenic
1170642071 20:18163210-18163232 CTCTTGTCTCTCTCTCTCTGAGG + Intronic
1171326357 20:24297024-24297046 CTCTTGGATCTCTGCAGCAGTGG + Intergenic
1171463429 20:25311667-25311689 CTCTTTAATCTCTCCAGCTGAGG + Intronic
1171897087 20:30817381-30817403 CTCTTAGATCTGTCTTTCTGAGG + Intergenic
1172893761 20:38285219-38285241 CTCTGGGATCACTCGATCTGGGG - Intronic
1173349257 20:42230086-42230108 CTCATGATTCTCTCCACCTGTGG - Intronic
1173860249 20:46278297-46278319 CTCTTGGTTCTGTGCATCTCTGG + Intronic
1174882791 20:54298911-54298933 CTCTTGGATCACTCACACTGGGG - Intergenic
1175271884 20:57739866-57739888 CTCTTGGATCACTTGCTCTGGGG + Intergenic
1175586328 20:60143367-60143389 ATCTGGAATCTCTCCATCTCTGG - Intergenic
1176049822 20:63112840-63112862 CTCTCGGGCCTCTCCTTCTGTGG - Intergenic
1176293500 21:5058721-5058743 CTCTTGCATCACTCCATCCCAGG - Intergenic
1177749337 21:25260568-25260590 CTCTTCAATCTGACCATCTGGGG - Intergenic
1178322896 21:31619231-31619253 CTCTTGGATTACTCATTCTGAGG + Intergenic
1178520538 21:33285529-33285551 CCTGTGGAACTCTCCATCTGGGG + Intronic
1179863760 21:44204927-44204949 CTCTTGCATCACTCCATCCCAGG + Intergenic
1182087641 22:27572425-27572447 CTCTTGGATCACGCATTCTGGGG + Intergenic
1182428005 22:30285036-30285058 CTCATGGTCCCCTCCATCTGAGG - Intergenic
1182980425 22:34665626-34665648 CTGCTGGATCCCTCCATATGGGG - Intergenic
1183091575 22:35525766-35525788 CTCCTGGATCTCACCACCTAAGG - Intergenic
1184080191 22:42213843-42213865 CTCTTGGAGGTCTTCTTCTGAGG + Exonic
1184168338 22:42743644-42743666 CCCTTTGGTCTCTCCCTCTGGGG + Intergenic
949202947 3:1402185-1402207 CACTTGGATATTTCCATCTGAGG + Intronic
950811339 3:15652372-15652394 ATCTTGGGTCCCTCCCTCTGGGG + Intergenic
950901539 3:16502603-16502625 CTCCTAGATCTCTCGTTCTGGGG + Intronic
951125124 3:18975582-18975604 CTCTTAGATTTGTCCTTCTGAGG + Intergenic
951243350 3:20312546-20312568 CTCCTGGATCACTCGCTCTGGGG - Intergenic
951522492 3:23622242-23622264 CTCTTGAATCACTCCCTCTGGGG + Intergenic
951567795 3:24028953-24028975 CTCCTCAGTCTCTCCATCTGAGG + Intergenic
951711514 3:25588838-25588860 CTCTTGAATCTCTTGCTCTGGGG - Intronic
952935455 3:38394929-38394951 CTCTTGGATCACTCACTTTGGGG - Intronic
952991563 3:38835386-38835408 CTCTTGGATCATTCACTCTGGGG - Intergenic
953874620 3:46659535-46659557 CTATTGGGTCTCTCTCTCTGAGG + Intergenic
954337026 3:49924753-49924775 CTCTTGGATCATTCCCTCTAGGG + Intronic
955931151 3:64058139-64058161 TTCTTGGATCGCTCAATCTTAGG - Intergenic
956117512 3:65933472-65933494 TTCTTGGATCTGTCACTCTGGGG - Intronic
956769403 3:72512006-72512028 CTCTTGAATCACTCTTTCTGGGG + Intergenic
957000942 3:74883981-74884003 CTCTTCGATCACTCCCACTGGGG - Intergenic
957354793 3:79067996-79068018 CTCTTGGATCACTCACTCTGGGG - Intronic
957734792 3:84190843-84190865 CTCTTGAAACTCCCCAACTGTGG - Intergenic
958925381 3:100151523-100151545 CTCTTGGATCACTCGGCCTGGGG - Intronic
960807958 3:121602148-121602170 CTCTCTGATCTCTCCGTCTCTGG + Intronic
961005482 3:123402495-123402517 CTTTTGAATCTCTCCATCCAAGG + Intronic
961561708 3:127734679-127734701 TCCTTGGATCTCTTCACCTGGGG - Intronic
962621135 3:137180699-137180721 CTCTAGGATCTTTGAATCTGTGG + Intergenic
962679419 3:137783242-137783264 CCCTTTGTTCACTCCATCTGAGG + Intergenic
964739317 3:159948996-159949018 CTCTTGGATCACTCACTCTGGGG + Intergenic
964810781 3:160661823-160661845 CTCTTGGATCCCTTGCTCTGGGG - Intergenic
965602273 3:170467217-170467239 CTCCTGGCTCTCGCCCTCTGTGG + Exonic
965678403 3:171224156-171224178 ATTTTGTCTCTCTCCATCTGTGG - Intronic
965751329 3:171977599-171977621 CTCTTGGATCACTAGTTCTGGGG + Intergenic
967859351 3:194139944-194139966 CTTTTAAATCTCTCCCTCTGGGG - Intergenic
971260785 4:25054795-25054817 CTCTTAGATCTCTCTCTCTCTGG - Intergenic
971730064 4:30367362-30367384 CTAGTGTATCTCTCTATCTGTGG + Intergenic
971739041 4:30497447-30497469 CTCTTTGATCTCCTCATATGAGG - Intergenic
972357352 4:38292675-38292697 CTCTTGGATCACTGACTCTGAGG + Intergenic
973714318 4:53660172-53660194 CTCTTGGATCACTCTTTATGGGG - Intronic
973939012 4:55884614-55884636 CTCTTGCATGTATCCATCTCTGG + Intronic
974696031 4:65373132-65373154 CTATTGGATTTCTCAATCTGAGG + Intronic
975799488 4:78044982-78045004 CACTGGGATCTTTCCATCAGCGG + Intergenic
977628316 4:99213665-99213687 CTCTTGTATCCCACCATCTTGGG - Exonic
979607053 4:122649690-122649712 CTCTTGGATTGCTCACTCTGTGG - Intergenic
980209682 4:129771458-129771480 CTCTTGGAATTCTCCCTCTCAGG - Intergenic
981804118 4:148693179-148693201 CTCACCGATCTCTCAATCTGTGG + Intergenic
982135624 4:152271859-152271881 CTCTGGGATCTCTCCAGGAGGGG - Intergenic
982290762 4:153780176-153780198 ATCATGGCTCTCTCTATCTGAGG + Intergenic
982660561 4:158201575-158201597 TTCTTGGATTTCTCACTCTGTGG + Intergenic
984132495 4:175895950-175895972 ATCCTGAATCTCTCCATCTGTGG + Intronic
986404917 5:7416125-7416147 CTCTGGGCTCTTTCCAACTGAGG - Intronic
988860277 5:35270247-35270269 CTCTTGGATCCCTCACTTTGGGG - Intergenic
989352873 5:40507192-40507214 TTCTTGGATCTTTGAATCTGAGG - Intergenic
989619618 5:43371491-43371513 CTCTTGGATCACTTTCTCTGAGG + Intergenic
990115630 5:52387155-52387177 CTTTTGAATCACTCCATCTGGGG - Intergenic
990328921 5:54706146-54706168 CTCTTTGATCTTTGCATCAGAGG + Intergenic
990713199 5:58606943-58606965 CTCTGGTTTCTCCCCATCTGTGG - Intronic
991994571 5:72374612-72374634 CTTTTGGATCACTTGATCTGGGG + Intergenic
992767417 5:80013963-80013985 GTCTGGAATCTCTCCTTCTGGGG - Intronic
992859923 5:80899434-80899456 GTCTTGGGGCTCTCCATTTGAGG + Intergenic
994274555 5:97820786-97820808 CTCTTAGATTTGTCCTTCTGAGG + Intergenic
994976831 5:106818832-106818854 CTCTTGGATCATTCACTCTGAGG - Intergenic
995487792 5:112656744-112656766 CTCTTGGATCACTGACTCTGAGG - Intergenic
996369203 5:122735351-122735373 CTGTTGGATCACTCAATCTGGGG - Intergenic
1000257827 5:159557650-159557672 CTCTTGCCTTTCACCATCTGAGG - Intergenic
1001585449 5:172831099-172831121 CTCTTGAATCACTCGTTCTGAGG - Intergenic
1001962680 5:175889585-175889607 CTCTTGGATTACTCACTCTGGGG - Intergenic
1003150986 6:3548775-3548797 CCCCAAGATCTCTCCATCTGTGG - Intergenic
1003543361 6:7037644-7037666 CTCTTAGATCACACCTTCTGGGG + Intergenic
1007487876 6:42194876-42194898 CTGATGGATCTCTCCAACTAGGG + Exonic
1007813212 6:44501219-44501241 CTCTTGGATCACTTACTCTGAGG - Intergenic
1012044372 6:94251102-94251124 CTCTTGGATCTCTTAAACTATGG - Intergenic
1013626620 6:111943968-111943990 CTCTTGGAGATCTGAATCTGAGG + Intergenic
1013781996 6:113739063-113739085 CTCTTGGATTACTTCCTCTGGGG - Intergenic
1015671076 6:135690129-135690151 CTCTTGGGTCTTTCACTCTGAGG - Intergenic
1018702492 6:166437906-166437928 TTCTTGTCTCTCTCCATCAGTGG + Intronic
1020945570 7:14601195-14601217 CTCCTGGGCCACTCCATCTGTGG - Intronic
1021992118 7:26149300-26149322 CTCTTGGAGCCCTCACTCTGGGG - Intergenic
1022251066 7:28609032-28609054 CTCTTGGAGCTTACCATCTAAGG + Intronic
1022301588 7:29107123-29107145 CTCTTGAATCTTTCAGTCTGAGG - Intronic
1022314857 7:29236278-29236300 CTCTTGGATTTCTCCAATAGTGG + Intronic
1022990394 7:35701566-35701588 CTTTTGGATCTCTCATTCTGGGG - Intergenic
1023624582 7:42103199-42103221 CTCTTGAATCCCTCACTCTGGGG - Intronic
1024103988 7:46062517-46062539 CTCTTGGATCACTAGCTCTGGGG - Intergenic
1024550026 7:50555044-50555066 CTCTCCCATCTCTCCATCCGAGG - Intronic
1025777195 7:64569895-64569917 CTCCAGGATCTCTCCCTCCGAGG + Intergenic
1026311582 7:69190426-69190448 CTACTGAGTCTCTCCATCTGAGG + Intergenic
1026600971 7:71776958-71776980 CTCCTGGTTCTCTGCACCTGGGG - Intergenic
1027649664 7:80851031-80851053 CCCTCCGATCTCTCCCTCTGTGG + Intronic
1028635642 7:92986053-92986075 CTCTTGAATCTATGCACCTGTGG + Intergenic
1029238205 7:99141574-99141596 CTCTGGGATCTTTGCTTCTGGGG - Intronic
1030034747 7:105399349-105399371 CTCTTGGATCATTCACTCTGGGG - Intergenic
1031691076 7:124788467-124788489 CCCTTGGCGCTCACCATCTGGGG - Intronic
1033656196 7:143376319-143376341 CTCAAGAAACTCTCCATCTGGGG - Intergenic
1034126044 7:148672362-148672384 CCCTTGGATTTCTCTCTCTGAGG - Intergenic
1035297610 7:157876046-157876068 TTCCTGGCTGTCTCCATCTGGGG + Intronic
1035324097 7:158053703-158053725 CTCTGGGGTCTCTGCATCTCTGG - Intronic
1035324100 7:158053720-158053742 CTCTAGGGTCTCTGCATCTCTGG - Intronic
1035324112 7:158053822-158053844 CTCTGGGGTCTCTGCATCTCTGG - Intronic
1035324119 7:158053873-158053895 CTCTGGGGTCTCTGCATCTCTGG - Intronic
1035324122 7:158053890-158053912 CTCTGGGGTCTCTGCATCTCTGG - Intronic
1035324127 7:158053941-158053963 CTCTGGGGTCTCTGCATCTCTGG - Intronic
1035324130 7:158053958-158053980 CTCTAGGGTCTCTGCATCTCTGG - Intronic
1035324135 7:158053992-158054014 CTCTAGGGTCTCTGCATCTCTGG - Intronic
1035324138 7:158054026-158054048 CTCTGGGGTCTCTGCATCTCTGG - Intronic
1035324141 7:158054043-158054065 CTCTAGGATCTCTGCATCTCTGG - Intronic
1035324148 7:158054094-158054116 CTCTGGGGTCTCTCCGTCTCTGG - Intronic
1035324151 7:158054111-158054133 CTCTAGGGTCTCTGCATCTCTGG - Intronic
1037754415 8:21701966-21701988 CTCTTGGACCGGCCCATCTGGGG - Intronic
1037820206 8:22131510-22131532 CTCCTGGTCCTCTCCATCTGTGG + Exonic
1038282399 8:26177906-26177928 CTCTTGGATGGCTCCTTCTGGGG - Intergenic
1038286180 8:26208181-26208203 CTCTTGGATCACTTGCTCTGGGG - Intergenic
1039596726 8:38797151-38797173 CTCTTGGATCACTCACTCTGGGG - Intronic
1039695169 8:39902920-39902942 CTCTTGTTTTTCACCATCTGGGG + Intronic
1040604549 8:48918636-48918658 CTCTTGCAGCTCTCTCTCTGTGG + Exonic
1041874271 8:62669700-62669722 CTTTTGTATCCTTCCATCTGGGG + Intronic
1042256536 8:66809941-66809963 CTCTTGGATCCCTCACTCTGGGG - Intronic
1043878508 8:85514263-85514285 CTCTAGGATCTCTCCTTCAAAGG + Intergenic
1044515696 8:93135910-93135932 CTCTTGGATTGCTCTCTCTGGGG - Intronic
1045317230 8:101053650-101053672 CTCTTGGATCAATCATTCTGGGG + Intergenic
1045349402 8:101324364-101324386 CTCTTGGATCACTTACTCTGGGG - Intergenic
1045487315 8:102641763-102641785 GTCTTGGATCACTCACTCTGAGG - Intergenic
1045907679 8:107367565-107367587 CTCTTTGATCACTCACTCTGGGG + Intronic
1046074115 8:109296810-109296832 CTCTTGGATCACACATTCTGAGG + Intronic
1047189563 8:122665830-122665852 CTCTTCCATCTCTCCCTCTCTGG + Intergenic
1048640468 8:136352845-136352867 TTCTAGGCTCTCTCCATCTTAGG - Intergenic
1048836794 8:138526603-138526625 CTCTTGTGTCTCTTCATCTACGG - Intergenic
1050051475 9:1606756-1606778 CTCTTAGATCTCTCAACCTCTGG + Intergenic
1050063999 9:1739303-1739325 CTCTAATATCTCTCCTTCTGTGG - Intergenic
1050518492 9:6471533-6471555 CTCTTGGATCACTCCCTCTGAGG + Intronic
1053124278 9:35567071-35567093 CTTTTGTTTCTCACCATCTGAGG - Intergenic
1053896458 9:42745906-42745928 CTATTGGATCTCTCCATTTCTGG - Intergenic
1056793838 9:89642967-89642989 CTCTTGGTTTTCTCACTCTGTGG + Intergenic
1056939190 9:90940721-90940743 CTCTTGGATCACTTACTCTGGGG + Intergenic
1057597131 9:96424081-96424103 CCCTTTCCTCTCTCCATCTGTGG + Intergenic
1057866672 9:98687062-98687084 CTCTTGGCCCTCTCCTGCTGAGG + Intronic
1058712052 9:107688093-107688115 ATCTTGCATCTCTCCACCTCAGG - Intergenic
1058764121 9:108164845-108164867 CTCATGAATCTCTCCATGTCTGG - Intergenic
1058838857 9:108886006-108886028 TTCTTAGGTCTCTCTATCTGAGG - Intronic
1059234949 9:112752967-112752989 CTCTTGGATCACTTGCTCTGGGG - Intronic
1059354353 9:113687530-113687552 CTCCTGGATCTCTCCTTCCTGGG + Intergenic
1061064131 9:128267043-128267065 CTCTGGGGTCCCTCCAGCTGAGG + Intronic
1061420259 9:130469785-130469807 CTCTAGAATCTCACCATCTTGGG + Intronic
1061541302 9:131278950-131278972 CTCTTGGATCTCTCCTTTGAGGG + Intergenic
1186406681 X:9310535-9310557 CTCTTTGATCACTCACTCTGAGG + Intergenic
1187080875 X:15986152-15986174 CTCTTGGATCACTCACTCTGGGG - Intergenic
1187127251 X:16465725-16465747 CTCTTGGATCACTTGCTCTGGGG + Intergenic
1188924458 X:36022600-36022622 CTCTTAGATTTGTCCTTCTGAGG + Intergenic
1189217563 X:39339661-39339683 CTCCTGAATCTCAGCATCTGAGG + Intergenic
1189443626 X:41060220-41060242 CTCTTGGATCACTTGTTCTGGGG + Intergenic
1189443952 X:41063393-41063415 CTCTTGGATCACTTGTTCTGGGG + Intergenic
1189733644 X:44047727-44047749 CTCTAGGATTTCTCTGTCTGTGG - Intergenic
1190236281 X:48618130-48618152 CTCTTGGATCTCTTGCCCTGTGG + Intergenic
1190580085 X:51884147-51884169 TTCTTGAATCACTCAATCTGTGG - Intronic
1192798388 X:74443445-74443467 CACTAGGCTCTCTCCATGTGTGG + Intronic
1193204694 X:78735000-78735022 CTCTTGGATTTGTCCTTCTGAGG + Intergenic
1196216603 X:113059899-113059921 CTCTTGGATCACGCACTCTGGGG - Intergenic
1196310529 X:114159216-114159238 CTTTTAGATGTCTCCATCTATGG + Intergenic
1198521063 X:137452998-137453020 CTCTTGGATCACCCACTCTGGGG - Intergenic
1199664408 X:150085072-150085094 CTCTCCCATCTCTCCCTCTGTGG - Intergenic
1200687558 Y:6270374-6270396 CTCATTGTTCTCCCCATCTGGGG + Intergenic
1201047714 Y:9904335-9904357 CTCATTGTTCTCCCCATCTGGGG - Intergenic
1201947098 Y:19522981-19523003 ATCTTGGATCTCTCCCTATCTGG + Intergenic