ID: 935697583

View in Genome Browser
Species Human (GRCh38)
Location 2:105783465-105783487
Sequence GAGCTAAGTCTGGCTCAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 135}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935697583_935697586 -1 Left 935697583 2:105783465-105783487 CCTGTCTGAGCCAGACTTAGCTC 0: 1
1: 0
2: 0
3: 5
4: 135
Right 935697586 2:105783487-105783509 CTTCATCTTCACCTGCTTGTGGG 0: 1
1: 0
2: 2
3: 16
4: 231
935697583_935697588 20 Left 935697583 2:105783465-105783487 CCTGTCTGAGCCAGACTTAGCTC 0: 1
1: 0
2: 0
3: 5
4: 135
Right 935697588 2:105783508-105783530 GGAAGCTTCGTACACCACCAAGG 0: 1
1: 0
2: 0
3: 11
4: 122
935697583_935697585 -2 Left 935697583 2:105783465-105783487 CCTGTCTGAGCCAGACTTAGCTC 0: 1
1: 0
2: 0
3: 5
4: 135
Right 935697585 2:105783486-105783508 TCTTCATCTTCACCTGCTTGTGG 0: 1
1: 1
2: 3
3: 30
4: 284
935697583_935697589 26 Left 935697583 2:105783465-105783487 CCTGTCTGAGCCAGACTTAGCTC 0: 1
1: 0
2: 0
3: 5
4: 135
Right 935697589 2:105783514-105783536 TTCGTACACCACCAAGGCACAGG 0: 1
1: 0
2: 2
3: 35
4: 458

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935697583 Original CRISPR GAGCTAAGTCTGGCTCAGAC AGG (reversed) Intronic
902879835 1:19364299-19364321 GTGCTCAGTCTGCCTCATACAGG - Intronic
905023292 1:34832836-34832858 GAGCCCAGCCTGGCTCATACAGG + Intronic
905413701 1:37790458-37790480 GAGCTTAGTCTTCCTCACACTGG + Intergenic
909094124 1:71266266-71266288 GAGGTATGTCTAGCTCAAACTGG - Intergenic
910032132 1:82740130-82740152 GAGCTATGTCTGGGTCAAAAAGG - Intergenic
910492670 1:87789732-87789754 GAGCTAAGACTGGCATAGACTGG + Intergenic
918318075 1:183339844-183339866 GAGCTATGTCTGCCTCAGGTGGG + Intronic
918666595 1:187158614-187158636 GTGGTAAATCTGGCTCTGACTGG + Intergenic
920431504 1:205921885-205921907 CAGCAAGGTCTGGCTCAGTCTGG - Intronic
920786603 1:209048490-209048512 AAGCTCAGTCTGACTCAGAGAGG + Intergenic
920877468 1:209849909-209849931 GAGCTGAAGCTGGCTCACACTGG + Intronic
922239845 1:223748490-223748512 AAGCAAATTCTGACTCAGACCGG + Intronic
1062854826 10:774729-774751 GCCCTAAGTCTGGCCCTGACTGG + Intergenic
1069561821 10:69436030-69436052 GGGCTGAGTGTGGCTCAGCCTGG - Intergenic
1071476171 10:86026977-86026999 GGGCTAAGTCTGGCTCACAGTGG + Intronic
1072962886 10:99945630-99945652 GTGCTAAATCTTGCTCAGAGAGG + Intronic
1076476620 10:130758148-130758170 GAGGAAAGTATGGCTCAGAGAGG + Intergenic
1077391074 11:2300910-2300932 GGCCTAGGTGTGGCTCAGACTGG - Intronic
1078342541 11:10509175-10509197 GGGCTAGGTTTGGCTCAGAGCGG + Exonic
1079443229 11:20535863-20535885 AAGCTCAGACTGGCTCAGACAGG + Intergenic
1080639699 11:34151650-34151672 GAGCTAAGTCTGGCATGGAGGGG - Exonic
1083214278 11:61208658-61208680 GTGCCAAGTCTGTCTCTGACGGG + Intronic
1083217162 11:61227487-61227509 GTGCCAAGTCTGTCTCTGACGGG + Intronic
1083220044 11:61246313-61246335 GTGCCAAGTCTGTCTCTGACGGG + Intronic
1083820919 11:65170987-65171009 GAGGTAAGTTTAACTCAGACCGG - Intronic
1085055610 11:73401831-73401853 GACCCAAGTCTGGCTTAGGCAGG + Intronic
1085327978 11:75622837-75622859 GTGCTAAAGCTGGCTCACACTGG + Intronic
1087878131 11:103383040-103383062 GGTCTAAGTCTGGCTCCGAGGGG - Intronic
1088940354 11:114447907-114447929 GAGTTAAGTGTGTGTCAGACTGG - Intronic
1089703140 11:120257692-120257714 GAGCAAAGTGAGGCTCAGAGGGG - Intronic
1091261913 11:134241414-134241436 GAGCCAATTCTGGGTCACACTGG - Intronic
1091405537 12:206996-207018 GAGCTGGGCCTCGCTCAGACCGG + Intronic
1100113102 12:91269599-91269621 GTGCTAAGACTGCCTCAGCCTGG + Intergenic
1102461997 12:113105749-113105771 GCGCTACGTCTGGCTCAGCGGGG - Exonic
1103191067 12:119002651-119002673 GAGATAAGGCTGTATCAGACAGG - Intronic
1108087970 13:46815831-46815853 GAGCAAAGTCTGGCTAAGCATGG + Intergenic
1114465130 14:22916564-22916586 GAGCTAATTCTTGATCAGAAAGG + Intronic
1115495786 14:34003224-34003246 AAGCTAGGTCTGTCTCTGACAGG - Intronic
1119029478 14:71180610-71180632 GAGCTCAGTAAGGCTCAGGCAGG + Intergenic
1119568980 14:75653306-75653328 AAGATAAGTCTGGGTCAGGCCGG + Intronic
1120101820 14:80453335-80453357 GAGCATAGTCTGGGTAAGACAGG + Intergenic
1122585594 14:102804001-102804023 CAGCTAATTCTCTCTCAGACAGG - Intronic
1127335944 15:57984204-57984226 GAGCAAAGTGTGGCTAAGAGGGG - Intronic
1128443092 15:67731680-67731702 GAGCCAACTCAGGCTCAGAGAGG + Intronic
1132881075 16:2161986-2162008 GAGCCTAGTCTGGGTCACACAGG + Intronic
1133654498 16:7847263-7847285 GAGCAAACTCTGGCTCAAATGGG - Intergenic
1135794192 16:25425740-25425762 GAACTAAGACTGGCTGAAACAGG + Intergenic
1136234500 16:28905536-28905558 GAGCTGGGCCTGGCTCAGCCTGG + Intronic
1137588586 16:49679623-49679645 GAGCTAAGGGTGGCTCAGCGTGG + Intronic
1141666898 16:85470327-85470349 GAGCTTAGTCTGGCTGCGGCTGG - Intergenic
1144309920 17:14004136-14004158 GAGCTAAGAATGGCTAAGAATGG - Intergenic
1145773591 17:27510869-27510891 AAGATAACTCTGGCTCAGAAGGG - Intronic
1146671229 17:34739422-34739444 GAACTAGGTCAGGCTCAGCCAGG + Intergenic
1147995716 17:44359450-44359472 GAGCAAATTATGGCTCAGAGAGG + Intronic
1149606625 17:57929590-57929612 GTTCTCAGACTGGCTCAGACTGG + Intronic
1153220409 18:2855751-2855773 GAGGAAAGTGTGCCTCAGACGGG - Intronic
1160148951 18:76384953-76384975 GAGGGAAGGCTGGCTCAGAAAGG + Intronic
1161619051 19:5288915-5288937 GGGCTGAGTCAGGCACAGACAGG + Intronic
1162041809 19:7975300-7975322 GAGCTGAGGCTGGCACTGACTGG + Intronic
1163262578 19:16200003-16200025 GAGGAAAGTGAGGCTCAGACAGG - Intronic
1164771296 19:30811392-30811414 GAGATAATTCTGCCGCAGACTGG - Intergenic
1165042382 19:33078168-33078190 GAGATAAGACTTCCTCAGACGGG - Intergenic
1165245486 19:34496199-34496221 GATCTCACTCTTGCTCAGACTGG + Intronic
928742199 2:34368509-34368531 GAGCTAGGTCTGGCTCTGCAAGG + Intergenic
929077592 2:38091274-38091296 GAGGAAAGTCAGGCTCAGAAGGG - Intronic
929683375 2:44013258-44013280 GAGCAAACTGAGGCTCAGACAGG + Intergenic
931147674 2:59537234-59537256 GAGATAAGTGTGGCTCTGAAAGG - Intergenic
931610320 2:64091689-64091711 GCCCTCAGTCTGGGTCAGACGGG + Intergenic
932576655 2:72965964-72965986 GAGCCCAGGCTGTCTCAGACAGG - Intronic
935697583 2:105783465-105783487 GAGCTAAGTCTGGCTCAGACAGG - Intronic
936786872 2:116104023-116104045 CAGCTATAACTGGCTCAGACTGG + Intergenic
940923584 2:159338339-159338361 GAGCTAAGTCCCTCTCTGACAGG + Intronic
1169261455 20:4141627-4141649 GAGCTAAGCTTGGATCAGATAGG + Intronic
1171316741 20:24202051-24202073 TAGCTAAGTCTGGCTGTGCCTGG + Intergenic
1171965310 20:31525324-31525346 AAGGTAAGACTGGCTCAGAGAGG - Intronic
1173662972 20:44746582-44746604 GAGAAAACTCTGGCTCAGAGAGG - Intronic
1177131312 21:17259473-17259495 TGGCTAAGTCTGGCTAAGTCTGG - Intergenic
1178487844 21:33030152-33030174 TAGCTGAGCCTGGCTCACACAGG + Intergenic
1180108903 21:45638328-45638350 GAACTGAGTCTGGCTCACAGAGG - Intergenic
1181164942 22:20978182-20978204 GAGCTATGGCTGGCTCAGTGGGG - Intronic
949265407 3:2151437-2151459 AAGCTCAGTCTGGCTGAGAAAGG + Intronic
955333387 3:58065753-58065775 GAGCTCAGTCTGGCCCACCCTGG - Intronic
955340107 3:58118512-58118534 GAGGAAACTGTGGCTCAGACTGG - Intronic
957851247 3:85810168-85810190 GAGCTATGACTGGCTGAGAAGGG + Intronic
958625543 3:96618222-96618244 GGGCTAGGTTTGGCTCAGAGTGG + Exonic
960117671 3:113912545-113912567 GAGACAAGTCTTGCCCAGACTGG - Intronic
960439711 3:117671672-117671694 GAGCTTAGTCTTGCTCAGCTAGG - Intergenic
962283417 3:134068479-134068501 GTGTTGAGTCTGGGTCAGACAGG - Intronic
964384924 3:156137337-156137359 GAGCTAAGGCTGGCTCAACAGGG + Intronic
966447854 3:180023828-180023850 GAGCTAGGTATGGCTCTGAAGGG - Intronic
967210127 3:187161190-187161212 GAGAAAAGTGAGGCTCAGACAGG + Intronic
967804505 3:193703439-193703461 AGGCTAACTCTGGCTCAGAGAGG + Intergenic
972589167 4:40467957-40467979 GAGTAAACTTTGGCTCAGACAGG - Intronic
975597819 4:76066829-76066851 GAGCAAAGTCAGGCTGAGCCTGG - Intronic
977546724 4:98391292-98391314 GAGGAAAGTCTGGCTTAGAGAGG - Intronic
977693801 4:99946312-99946334 GGGCTGGGGCTGGCTCAGACAGG + Intronic
983651425 4:170040421-170040443 GAGCAAAGTCTGGCCAAGCCTGG + Intergenic
994631055 5:102288460-102288482 GAGATAAATGTGGCTGAGACTGG - Intronic
996817139 5:127586933-127586955 GAGCTCATTCTGGCTGACACTGG - Intergenic
999131651 5:149288321-149288343 GAGCCAAGTGAGGCTCAGAGAGG - Intronic
999238911 5:150116104-150116126 GAGGAAAGTGTGGCTCAGAGAGG + Intronic
999674408 5:153984531-153984553 GTGGCAAGTGTGGCTCAGACTGG - Intergenic
1002100315 5:176854475-176854497 GAGCCCAGTGTGGCTCAGCCGGG - Intronic
1002660977 5:180791068-180791090 GGGCTAAGTGGGGGTCAGACAGG + Exonic
1002711840 5:181199831-181199853 CAGGTAAGTCTGGCTCAGCCAGG - Exonic
1006921354 6:37629640-37629662 GAGCAAAGTGAGGCTCAGAAAGG - Intergenic
1006928243 6:37671218-37671240 GTGCTAAGTCTTTCTCAGAGAGG - Intronic
1007223164 6:40294740-40294762 GAGCTGTGTCTCCCTCAGACTGG - Intergenic
1007243984 6:40446898-40446920 GAGCTGTGTCTCCCTCAGACTGG + Intronic
1007243992 6:40446936-40446958 GAGCTGTGTCTCCCTCAGACTGG + Intronic
1007707129 6:43797932-43797954 GGGCTAAACCTCGCTCAGACTGG - Intergenic
1007740049 6:44004607-44004629 GGGCTGTGTCTGCCTCAGACTGG + Exonic
1013633355 6:112006363-112006385 GCCCTAAGTCTGGCTCACAGTGG - Intergenic
1016723334 6:147328318-147328340 GAGTTAAGTATGCCTCAAACAGG - Intronic
1018194686 6:161344922-161344944 AAGATAAGTCTAGCACAGACTGG - Intergenic
1019603516 7:1897160-1897182 GGGCTAAGGCTGAATCAGACAGG + Intronic
1019982180 7:4629727-4629749 GAGCTCAGTCAGGCTCCGAGAGG + Intergenic
1022232464 7:28427709-28427731 GAGCGAAGTCTGGCTAGGAGGGG - Intronic
1023394946 7:39743979-39744001 GAGCTAAGTTTGGCTCAGCTGGG - Intergenic
1026292971 7:69025323-69025345 GAGCTAAGTCTGTCCCTCACTGG - Intergenic
1027418631 7:77998428-77998450 GAGCTCAGTCTAGCCCAGAAGGG + Intergenic
1031638359 7:124130256-124130278 GAGCCAACTCTGGGTTAGACAGG + Intergenic
1032266146 7:130371330-130371352 GAGGTGACTCAGGCTCAGACAGG + Intergenic
1035474477 7:159132372-159132394 GAGCTCAGCCTGGGTCTGACAGG + Intronic
1035478778 7:159164516-159164538 GAGCTCAGCCTGGGTCTGACAGG - Intergenic
1038530217 8:28312477-28312499 GTGCTAATTGTGGATCAGACTGG - Intergenic
1038671780 8:29588930-29588952 GAGATGAGTCTGGCTCAGCAGGG - Intergenic
1039003063 8:33003163-33003185 GAGCTAAAGCTGGCTCAAAGTGG + Intergenic
1042638936 8:70911056-70911078 GAGCTAAGCCTGGATTATACAGG - Intergenic
1043101076 8:76046584-76046606 GAGCGAACTCAGGCTCAGATGGG + Intergenic
1044942157 8:97354295-97354317 GAGCTAAGGCTGGCAGAGAAAGG - Intergenic
1045211898 8:100107443-100107465 GAGCTAATCGTAGCTCAGACCGG + Intronic
1048796259 8:138152708-138152730 GAGATAAGTATGGATTAGACAGG - Exonic
1052691464 9:31821116-31821138 TAGCTGAGTCTGGCTGAGTCTGG - Intergenic
1056658661 9:88529043-88529065 TTGCTAAGACTGGCTCAGGCAGG + Intergenic
1057718947 9:97517366-97517388 GAGCTTTGTCAGGCTCAGGCTGG + Intronic
1058103990 9:100949500-100949522 CAGATCAGTCTGGCTCAGAGGGG - Intergenic
1059415753 9:114161626-114161648 GGGCTAAGGCTGGGACAGACAGG - Intronic
1059700781 9:116773717-116773739 GAGGAAACTCTGGCTCAGAGAGG + Intronic
1187227457 X:17387313-17387335 GAGGTTAATCTGGCTCAAACTGG + Intronic
1193862798 X:86691778-86691800 TAGCTAAGGCTGCCACAGACAGG - Intronic