ID: 935703495

View in Genome Browser
Species Human (GRCh38)
Location 2:105835635-105835657
Sequence TTAAGGATCTTAGAGTTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 229}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935703493_935703495 9 Left 935703493 2:105835603-105835625 CCTTGGAGAGGACTTTCTTAGGT 0: 1
1: 0
2: 0
3: 21
4: 166
Right 935703495 2:105835635-105835657 TTAAGGATCTTAGAGTTTCCTGG 0: 1
1: 0
2: 2
3: 22
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935703495 Original CRISPR TTAAGGATCTTAGAGTTTCC TGG Intronic
903194038 1:21671797-21671819 TTAAGGACCTTGGAGTCTGCAGG - Intergenic
904838657 1:33356011-33356033 TTTAGGTTCTTAAAGTATCCAGG + Intronic
904845114 1:33406190-33406212 TTAATATTCTTAGATTTTCCTGG + Intronic
905417778 1:37816124-37816146 TAAAGGAGCTCAGAGTCTCCTGG - Intronic
905867539 1:41384308-41384330 TTAAGGAACTTAGAGGCTCCTGG + Intergenic
907137833 1:52156391-52156413 TTAAGGATCTCAAAGATTCAAGG - Intronic
907758562 1:57335132-57335154 TTAAGAATTTAAGAGTTTCCTGG + Intronic
910813263 1:91259664-91259686 TTAAGGAACTTAGATTTACAAGG + Intergenic
912046720 1:105468342-105468364 TTATGGAACGTAGAGTTTCCTGG + Intergenic
912130923 1:106598867-106598889 TTAAGCAATTTAGAGTTTCAAGG - Intergenic
912573971 1:110647452-110647474 ATAAGGACCTTGAAGTTTCCTGG + Intergenic
914203007 1:145503214-145503236 TTAAGGATCTTACAGCTTTTGGG - Intergenic
914236937 1:145821148-145821170 TTAAGGATCTTACAGCTTTTGGG - Intronic
914446426 1:147754291-147754313 TTTTGGATCTTAGAGTTTGGTGG - Intergenic
914482129 1:148076365-148076387 TTAAGGATCTTACAGCTTTTGGG - Intergenic
915926437 1:160023958-160023980 TTATGGATCTTACATTTTCATGG - Intergenic
915949654 1:160180518-160180540 TTAAGGAACTTAGAGTCTAGTGG - Intronic
916840323 1:168593974-168593996 TGATGGATCTTACTGTTTCCAGG + Intergenic
916945474 1:169721925-169721947 CTAAGGAACTTAGAGTTTAGTGG + Intronic
917658060 1:177147415-177147437 TTAAGGAGCTTACAGTTGCAGGG + Intronic
919365575 1:196656428-196656450 TTACAAATGTTAGAGTTTCCTGG + Intronic
919970889 1:202577447-202577469 ATAAGTATCTTAGGGTTTGCAGG - Intronic
920278401 1:204825465-204825487 ACAAAGATCTTAGAGTCTCCAGG - Intergenic
924203045 1:241680452-241680474 TTCAGGATCTTGGAGTTTAGGGG - Intronic
924596442 1:245448934-245448956 TTAAGGATTTAATAGTTTCTGGG - Intronic
1064701406 10:18024806-18024828 TTAAGGATTTTATGTTTTCCTGG + Intronic
1065787585 10:29230499-29230521 AGAAGGATCTAAGAGTCTCCAGG - Intergenic
1068183432 10:53552658-53552680 TTTAAGATCTTAAATTTTCCTGG - Intergenic
1069781621 10:70959751-70959773 CTATGGATCTCAGAGTTCCCTGG - Intergenic
1071836254 10:89420901-89420923 TCAAGGAACTTAGGATTTCCTGG - Exonic
1071954671 10:90744602-90744624 TTAAGGATTTTACAGTATACAGG - Intronic
1072782950 10:98262520-98262542 TCAAGGAACTTAGAGTTTAGTGG + Intronic
1072978150 10:100076961-100076983 TTGAGGATCTGAAAGTTTCTGGG + Intronic
1073515614 10:104073060-104073082 TCGAGGAGCTTAGAGTATCCTGG - Intronic
1074008694 10:109455604-109455626 GTTAGGATGTTAAAGTTTCCAGG + Intergenic
1074763982 10:116687101-116687123 TTCAGGATGTGAGAGTGTCCTGG - Intronic
1076246303 10:128950142-128950164 CTAAGGAGCTTGGAGTGTCCAGG - Intergenic
1077667716 11:4128819-4128841 TTATGAATGTTAGAGTTTTCTGG + Intronic
1078882530 11:15466292-15466314 TTAATGATCTTGGATTCTCCAGG - Intergenic
1080329392 11:31118006-31118028 TAAAGGTTTTTGGAGTTTCCTGG + Intronic
1080607898 11:33879086-33879108 TTAAGAATGTTATAGTTACCAGG - Intronic
1084700160 11:70781410-70781432 TTAAGGCTCTCAGAGATGCCTGG - Intronic
1089066775 11:115668068-115668090 TTAAGTAACTTACGGTTTCCTGG + Intergenic
1090532769 11:127608240-127608262 TGATGGATCTTAGAGTATCTTGG + Intergenic
1090632496 11:128662316-128662338 TTAAGGAACTCACAGTTTACTGG - Intergenic
1092930006 12:13306928-13306950 TCTAGGATCCTAGAGTTTCTTGG - Intergenic
1093640925 12:21526559-21526581 ATAAGGATTTTAGAGTTTAAAGG + Intronic
1095395772 12:41760877-41760899 TTAAGGAGCTTACAGTTTTGTGG + Intergenic
1095456854 12:42396511-42396533 TGAAGGATATTAGAATGTCCTGG + Intronic
1096228253 12:49882871-49882893 TTAAGGAACTTAGATTCTGCTGG + Intronic
1096822214 12:54245427-54245449 TTAAGGATCTCTGACATTCCAGG + Intronic
1100699468 12:97130926-97130948 TTAAGGATATAAGAGGTTCCAGG - Intergenic
1101255957 12:102976873-102976895 TAAAGCATCATGGAGTTTCCTGG - Intergenic
1101750639 12:107580461-107580483 TTGAGGCTCTCAGAGTTTCAGGG + Intronic
1103018835 12:117517482-117517504 TTCAGGATCTTTGAGATTCGAGG + Intronic
1106256910 13:28030500-28030522 TCCTGGATCTTAGAGTCTCCTGG + Intronic
1106561552 13:30850922-30850944 TTAAGTTTCTTATAGTTTCTGGG + Intergenic
1109105092 13:58240143-58240165 TTAAGGAGCTGAGGTTTTCCTGG - Intergenic
1109360684 13:61291818-61291840 TTCAGGATGTTTGAGTTCCCAGG + Intergenic
1112455765 13:99561361-99561383 TTAAGTTTCTTAGAGTTGCCTGG + Intronic
1113265745 13:108616095-108616117 TCAAGTAACTTATAGTTTCCTGG - Intronic
1115274117 14:31587879-31587901 TTAAAGATTTTATAGTTGCCTGG + Intronic
1115970721 14:38941933-38941955 TTAAGGAGCTTAGAATTTTTTGG - Intergenic
1116044828 14:39731985-39732007 TTAAGGATCTCCGAGTAGCCAGG + Intergenic
1116425666 14:44787557-44787579 TTAAGGAGCTTACAGTTTGAAGG + Intergenic
1117019205 14:51551931-51551953 TTAATGTTCTTAGAGTTTTATGG + Intronic
1117325877 14:54668443-54668465 AAAAGGATCTTGGAGTTTACAGG + Intronic
1118162974 14:63309503-63309525 TTCAGGATTTGACAGTTTCCAGG - Intergenic
1119053502 14:71393893-71393915 TTAAGCATATCAGATTTTCCAGG - Intronic
1119968798 14:78946458-78946480 TAAAGGAGCTTAGAGTCTGCTGG - Intronic
1120224589 14:81776426-81776448 TTAAACATCTTACATTTTCCTGG + Intergenic
1122022320 14:98848432-98848454 TCAAAGATGTTAGAGTCTCCAGG + Intergenic
1129098348 15:73233574-73233596 TTAAGGAGCTTATAGATTCGTGG + Intronic
1129634687 15:77302750-77302772 TTTAGGAGGTCAGAGTTTCCAGG - Intronic
1132072743 15:98793837-98793859 TTAAGGGTCTCAAAGATTCCAGG - Intronic
1132225565 15:100138232-100138254 TTTAGGATCTTAGAATTCCATGG + Intronic
1132913997 16:2332246-2332268 TGAAGGATTTTAAAGTTTCAAGG - Intronic
1134207332 16:12248853-12248875 TTAAGGAGCTTAGATTCTACTGG - Intronic
1134300050 16:12982807-12982829 TTAAGTATCTTATTCTTTCCAGG - Intronic
1135345568 16:21685896-21685918 TTAAGGATCTGAGAATCTCCTGG + Intronic
1137903544 16:52295346-52295368 TTATGGAGCTTACAGTTTCTTGG + Intergenic
1138622480 16:58222989-58223011 TTAGGGATCCTATATTTTCCAGG + Intergenic
1138824360 16:60301017-60301039 TTAAGGACCTCAGCTTTTCCTGG + Intergenic
1139934694 16:70560965-70560987 TTAAGAATGTTAGTGTTTCTGGG + Intronic
1140540908 16:75755636-75755658 TCAAGAATCTGAGAGTTTCCAGG - Intronic
1141328905 16:83089969-83089991 TGAGGGATCTTAGAGGCTCCTGG - Intronic
1144718980 17:17454627-17454649 TTAAGGTACTTAGAGATTCCAGG - Intergenic
1148136854 17:45298788-45298810 TTGAGGATCTTACAGTCTACTGG + Intronic
1153009246 18:523060-523082 TCAAGGATCTTAGTGTTTACCGG + Intergenic
1154490785 18:14920521-14920543 TTAGGGATCTTGTAGCTTCCTGG + Intergenic
1155473453 18:26214506-26214528 TTAAGGAACTTAAAGTGTTCTGG + Intergenic
1155837239 18:30601330-30601352 TTAGGAATATTAGTGTTTCCTGG + Intergenic
1156820080 18:41361704-41361726 ATAAGTATCATAGAGTCTCCAGG + Intergenic
1159380742 18:67655098-67655120 GTAAGAATCTGAGATTTTCCTGG + Intergenic
1159470675 18:68851271-68851293 CTAAGGATTTTAGATTTTCCAGG + Intronic
1160206205 18:76835488-76835510 TGAAAGATCTTATATTTTCCTGG + Intronic
1163903151 19:20125529-20125551 TGAGGGATTTTAAAGTTTCCAGG + Intronic
1168551473 19:57299759-57299781 TTGGGGATCTTTGAGCTTCCTGG + Intergenic
926979657 2:18554834-18554856 TCAAGTATCTTTGAGTTTCATGG - Exonic
927524261 2:23722714-23722736 TTGAGGTTCTTTGAGCTTCCTGG - Intergenic
928392382 2:30919542-30919564 TTGAGGACCCTAGAGTCTCCAGG + Intronic
930949685 2:57125230-57125252 TTAAAAATTTTATAGTTTCCAGG - Intergenic
933382566 2:81568269-81568291 TCAAGGACCTTAGAGATACCTGG - Intergenic
935087473 2:99862141-99862163 TAAATGATTTTAAAGTTTCCAGG + Intronic
935275585 2:101473239-101473261 TTTAGTAAATTAGAGTTTCCAGG - Intronic
935348413 2:102130961-102130983 TTACTGATGTGAGAGTTTCCAGG + Intronic
935703495 2:105835635-105835657 TTAAGGATCTTAGAGTTTCCTGG + Intronic
937721088 2:125097173-125097195 TTAAAGATCTGAGAGTGTACAGG + Intergenic
939734908 2:145831534-145831556 TTGATGTTCTTTGAGTTTCCTGG - Intergenic
940403859 2:153278227-153278249 TTAAGTTTCTTAAAGTTTCAGGG + Intergenic
944444494 2:199775764-199775786 TTGAGGACCTTATAGGTTCCAGG + Intronic
944945214 2:204676484-204676506 CTAAGGATCTTTGAGGTTCTAGG + Intronic
947939469 2:234037019-234037041 TTGAGGATCCCTGAGTTTCCTGG - Intergenic
948754435 2:240150775-240150797 TTCAGGATCTTGGAGTGTCCTGG + Intergenic
1170410418 20:16083358-16083380 TTAAGGACCTTTGAGCTTCCTGG - Intergenic
1171362457 20:24597541-24597563 TTAGGGATCTCAGAGCCTCCAGG - Intronic
1172814642 20:37676747-37676769 TAAAGGATCTCAGTGTTTTCAGG - Intergenic
1173717082 20:45217907-45217929 TTAGGGTTCTTATAGCTTCCTGG + Intergenic
1174403520 20:50289146-50289168 AAAAGCATCTTAGAGTCTCCTGG - Intergenic
1174695978 20:52559405-52559427 TTGGGGATCTTTGAGCTTCCTGG + Intergenic
1174801648 20:53568532-53568554 TCAAGGATCCTGGAGGTTCCAGG + Exonic
1175783320 20:61697164-61697186 TGAAGGATCCTAGGGGTTCCTGG + Intronic
1178288799 21:31348981-31349003 TAAAAGCTATTAGAGTTTCCTGG - Intronic
1178631328 21:34263883-34263905 TTAAGGAACTTAGAGTCTGATGG - Intergenic
1183150437 22:36032780-36032802 TTAATGATGTTAGATCTTCCTGG + Intergenic
1183791989 22:40079265-40079287 AGAAGCATCTTAGAGCTTCCAGG - Intronic
1183916193 22:41121604-41121626 TAGAGGAGCTTGGAGTTTCCAGG + Intronic
1185274616 22:49944948-49944970 TAAAGGGGCGTAGAGTTTCCTGG - Intergenic
1185274626 22:49944995-49945017 TAAAGGGGCGTAGAGTTTCCTGG - Intergenic
1185274636 22:49945042-49945064 TAAAGGGGCGTAGAGTTTCCTGG - Intergenic
1185274646 22:49945090-49945112 TAAAGGGGCGTAGAGTTTCCTGG - Intergenic
1185274656 22:49945137-49945159 TAAAGGGGCGTAGAGTTTCCTGG - Intergenic
1185274666 22:49945184-49945206 TAAAGGGTCGTAGAGTTTCCTGG - Intergenic
949685782 3:6568434-6568456 TTAAGGATATTAGAATTCACAGG - Intergenic
951016060 3:17733810-17733832 TTAATTCTCTTAGATTTTCCAGG - Intronic
951345359 3:21542307-21542329 TAAACCATCTTAGAGATTCCTGG + Intronic
951693878 3:25426064-25426086 TTAAGGTCCTTAGAGTTCCTTGG - Intronic
952182731 3:30935526-30935548 ATAAGGATCTTGGAATTTTCAGG - Intergenic
952351721 3:32545640-32545662 TTAAGCATCTTAAGGTATCCTGG - Intronic
955864015 3:63362578-63362600 TCAAGGATCTTAGAGTCTGGTGG + Intronic
956581978 3:70824104-70824126 TTAAAGTTCTAGGAGTTTCCAGG - Intergenic
956711267 3:72040690-72040712 TAAAGGAGCTTAGAGTTTACTGG - Intergenic
957679314 3:83411751-83411773 TTAAGGATCTCATAGTTTCCTGG + Intergenic
959105262 3:102058277-102058299 TTAAGGACCTTAGAGTATAGTGG + Intergenic
959185288 3:103039001-103039023 TTATAGATCTTAGAGTTAACTGG - Intergenic
959335218 3:105055896-105055918 TTAAAGATCTTGGAATTTCTCGG + Intergenic
959552544 3:107679367-107679389 TTCAGGCTCATAGAGTTTTCTGG + Intronic
959626354 3:108456559-108456581 TTAAGGATATTACAGTTACATGG + Intronic
960184461 3:114621727-114621749 TTAATGAAATTAGAATTTCCAGG + Intronic
963562348 3:146881707-146881729 TTTAGGATCTGAGAATTTCAGGG - Intergenic
963940149 3:151089122-151089144 TTAAGAAACTTTGTGTTTCCTGG + Intronic
964427994 3:156573273-156573295 CAAAGGAACTGAGAGTTTCCTGG - Intergenic
964477982 3:157113831-157113853 TTAAGAATCTTTGAGTCTACTGG + Intergenic
965948180 3:174268384-174268406 TTAAGGCTGTTAGCGTTTTCTGG - Intronic
966207021 3:177415391-177415413 TTGAGGATCTTCCAGTTGCCAGG - Intergenic
966366613 3:179194909-179194931 TTAAGGGTCTCATAGTTTACTGG - Intronic
968742845 4:2340056-2340078 TCAAGGAGCTTGGAGCTTCCAGG + Intronic
970018194 4:11536230-11536252 CTTAGGATCTAAGAGTTTCCAGG + Intergenic
972763839 4:42133024-42133046 TTAAGTATTTTACTGTTTCCAGG - Intronic
975804890 4:78101623-78101645 TCAAGGAACTGAGAATTTCCAGG + Intronic
977400531 4:96525618-96525640 TTCAGGATTGTAGAGCTTCCAGG - Intergenic
977633261 4:99266957-99266979 TTAATAATCTTAGATTTACCAGG + Intergenic
977883193 4:102229815-102229837 TCATGGAACCTAGAGTTTCCTGG - Intergenic
979015809 4:115432377-115432399 TTAAAGATTTTGGAGTTGCCTGG - Intergenic
984622038 4:181964560-181964582 TTAAGGAACTTAGAGTGTTGGGG - Intergenic
984654160 4:182299606-182299628 TTACAGATCTTAGAGTTAGCAGG + Intronic
984673464 4:182518754-182518776 TTTATGATCTTACAGTTTGCAGG - Intronic
986983658 5:13476550-13476572 TTTACCATCTTTGAGTTTCCTGG + Intergenic
988360765 5:30233583-30233605 TGAAGGATCTTTGTGTGTCCTGG + Intergenic
988645024 5:33085352-33085374 TTAAGGATTTCAGAATTTCAAGG - Intergenic
988841282 5:35086307-35086329 TTAAAGATCTCAGGTTTTCCAGG + Exonic
989131678 5:38113366-38113388 TTTAGGAACTCACAGTTTCCTGG + Intergenic
989803518 5:45575287-45575309 ATAAGGACCTTAGAATTTTCAGG - Intronic
989810821 5:45671457-45671479 TTAAGGATCTTACAGTCTAGTGG - Intronic
991465535 5:66908510-66908532 TTAATGTTCTTAGAGTTTCGGGG + Intronic
991540699 5:67724750-67724772 TAAAAGATCTTATAGTTTACTGG + Intergenic
993323713 5:86507676-86507698 TTAAGCATCTTAAACTTACCAGG + Intergenic
993982031 5:94554133-94554155 TTATGGAGCTTAGAGTTTCAGGG - Intronic
995396737 5:111694968-111694990 TTCAGGATATTAGGTTTTCCTGG + Intronic
996136767 5:119852344-119852366 TTACTGACCTGAGAGTTTCCAGG - Intergenic
996365638 5:122697514-122697536 TTAAGGAACTTAGAATTAGCTGG + Intergenic
1000260226 5:159580995-159581017 TTTAGGGTCTCAGAGTTTACGGG - Intergenic
1000499449 5:162030809-162030831 TTAAATATCTTAGAGTTCCCTGG - Intergenic
1003058761 6:2845986-2846008 TAAATGATTTTAGACTTTCCTGG - Intergenic
1004125484 6:12868865-12868887 TTGAGGTTCTTATATTTTCCTGG - Intronic
1004275065 6:14228904-14228926 TTCAGGAGCTTAGAGTTACGTGG - Intergenic
1005471984 6:26170273-26170295 TTATGGACCTTACAGTTTTCAGG - Intronic
1006639371 6:35481317-35481339 TCAAGGATCTGTGTGTTTCCTGG - Intronic
1007538462 6:42618357-42618379 TCAAGGATCTTCAAGTGTCCTGG - Intronic
1008336135 6:50307042-50307064 TTAAGGATGATTCAGTTTCCAGG - Intergenic
1008596109 6:53043721-53043743 TTAAAGAGCTTAGAGTCTCCTGG + Intronic
1008666562 6:53722635-53722657 TTTAAGATCTGAGAGTTTCTGGG + Intergenic
1008798306 6:55334343-55334365 TTAAGGAACTCAGTGTCTCCTGG + Intronic
1009535859 6:64884120-64884142 TTAAGAATCATAAACTTTCCTGG + Intronic
1010566028 6:77415145-77415167 TTAAGGGTCCTAGAATTTTCAGG + Intergenic
1010584580 6:77642386-77642408 CTAAGGACCTCAGAGTCTCCTGG - Intergenic
1011808472 6:91100325-91100347 TTAATTATCTTAGATTTTCTAGG + Intergenic
1012290044 6:97443051-97443073 TTAACTATCTTAGAGATTCATGG + Intergenic
1012635930 6:101541535-101541557 TCAAGGATCTTAGAGATCACTGG - Intronic
1013644274 6:112120721-112120743 TTAAGGATCTTACTGTGTCTTGG + Intronic
1014783769 6:125594539-125594561 GTAAGCATCTTAGATTTTGCTGG - Intergenic
1015066118 6:129030900-129030922 TCAAGGAACTTAGAGTTTAGTGG + Intronic
1015132394 6:129828059-129828081 TTAAGGAGCAGAGATTTTCCTGG - Intergenic
1015531205 6:134222948-134222970 TTAAGCAAATTAGAGATTCCTGG - Intronic
1016881894 6:148919788-148919810 TTAAGCCTTTTAGACTTTCCAGG + Intronic
1017248396 6:152252841-152252863 TTAAGGATCTAAGAGAATCATGG - Intronic
1018386066 6:163304530-163304552 TTAAGGGTTTTAGAGTAACCTGG + Intronic
1020412704 7:7911010-7911032 TCAAAGATCATAGAGTTTTCTGG - Intronic
1020533858 7:9369397-9369419 TTAAGTTTCTTAGAGATTCTGGG - Intergenic
1021047178 7:15938180-15938202 TGAAGGATCTCAGTGATTCCTGG + Intergenic
1021289145 7:18822047-18822069 ATAAGGTTCAGAGAGTTTCCAGG - Intronic
1024478409 7:49838721-49838743 TTTAGGACCTAAAAGTTTCCAGG + Intronic
1025974573 7:66359486-66359508 CTAAGGTTCTTAAAGTGTCCAGG - Intronic
1026064855 7:67061523-67061545 TTAAGGATCTTTGGCCTTCCAGG + Intronic
1029107294 7:98188808-98188830 TTAAGGACCTTTGAGCTTCCTGG + Intronic
1029914182 7:104189625-104189647 ATGAGGTTCTGAGAGTTTCCAGG + Intronic
1030198870 7:106881460-106881482 GTAAGGATGTTAGAGTTTTGTGG + Intronic
1031692979 7:124813693-124813715 TTAAAGATCTTCCAGTTTACTGG + Intergenic
1031990962 7:128198567-128198589 TTAATAATCTTAGAGTTTCCTGG - Intergenic
1033382583 7:140837652-140837674 TTATGGAACTTAGATTTGCCTGG + Intronic
1034214012 7:149389617-149389639 TTAAGGTTCTTGCAGTTTCATGG + Intergenic
1037059696 8:14491887-14491909 TAAAGGATTTTACAGTATCCAGG - Intronic
1037477120 8:19268885-19268907 TGAAGGACTTTAGACTTTCCTGG - Intergenic
1038328133 8:26587832-26587854 TTCAGGATCTCAGAGTTTCTAGG + Intronic
1039517450 8:38145731-38145753 TTAAGGTTCTTAAACTTTCTGGG + Intronic
1040415615 8:47192116-47192138 ATCAGTATCTTAGAGTTTCATGG - Intergenic
1041451868 8:58014183-58014205 CTTAGGATCATAGAGCTTCCTGG + Intronic
1041495897 8:58484929-58484951 TTTAGAATCATAGAGTCTCCAGG - Intergenic
1041928420 8:63261725-63261747 TTGTGGATTTTAGAGTTTCATGG - Intergenic
1042637302 8:70892839-70892861 TTGAGGATCTTTGAGATTCTTGG + Intergenic
1042664686 8:71192397-71192419 ATAAGGAGATTAGAGTTTTCAGG + Intergenic
1043672750 8:82908594-82908616 TTAAGGGCCCTAGAGTTTCTGGG + Intergenic
1043850180 8:85207122-85207144 TTAAGAATCTCAGACTTTACAGG + Intronic
1045454266 8:102360648-102360670 TTTAGGATGGTAGAGTTTGCAGG - Exonic
1045778678 8:105837642-105837664 TTCAGGAATATAGAGTTTCCTGG - Intergenic
1046402244 8:113719111-113719133 TTAGGCATTTGAGAGTTTCCAGG - Intergenic
1049313355 8:141945871-141945893 TTAAGGATTTCTGAGATTCCTGG + Intergenic
1050857926 9:10385297-10385319 TTAAGGAGCTTAAAGTTTAGTGG - Intronic
1051084869 9:13336983-13337005 TTAAGGATCCTAGGATTTTCAGG - Intergenic
1051184810 9:14449046-14449068 TTCAGGAACTTAAAGTTTCATGG - Intergenic
1058061597 9:100502694-100502716 TTTATAATCTTAGAGTTTCAGGG - Intronic
1058091698 9:100813309-100813331 TTAAGGAGCTTATAGTTTAGTGG + Intergenic
1059450240 9:114367235-114367257 TGAAAGAGCTCAGAGTTTCCCGG + Intronic
1186001525 X:5017386-5017408 TCCAAGATCTTAGAGTTTCCTGG - Intergenic
1186406579 X:9309581-9309603 TTAAGCATTGAAGAGTTTCCAGG - Intergenic
1192619528 X:72663514-72663536 TTTGGGAACTTTGAGTTTCCTGG - Intronic
1193483882 X:82061504-82061526 TAAAGAATCTCAGAGTTTGCAGG + Intergenic
1195410663 X:104565689-104565711 TTAAGGATCTTATAGGTGGCAGG + Intergenic
1199559747 X:149150337-149150359 TTCTGGCTTTTAGAGTTTCCAGG + Intergenic
1199840264 X:151639348-151639370 TCATGGATCTTACAGTTTCATGG - Intronic
1202168811 Y:22019446-22019468 TTAAGGTACTGAGATTTTCCAGG - Intergenic
1202222550 Y:22566922-22566944 TTAAGGTACTGAGATTTTCCAGG + Intergenic
1202320565 Y:23628738-23628760 TTAAGGTACTGAGATTTTCCAGG - Intergenic
1202550202 Y:26041318-26041340 TTAAGGTACTGAGATTTTCCAGG + Intergenic