ID: 935707530

View in Genome Browser
Species Human (GRCh38)
Location 2:105870020-105870042
Sequence ACAAGGACCCATGTGGTGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 133}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935707530 Original CRISPR ACAAGGACCCATGTGGTGGT CGG Intronic
900001512 1:17303-17325 ACAAAGACCCATGTGATGCTGGG - Intergenic
900021231 1:187825-187847 ACAAAGACCCATGTGATGCTGGG - Intergenic
903277843 1:22233049-22233071 AGAAGCAGCCATTTGGTGGTAGG + Intergenic
903775349 1:25789906-25789928 CCAGGGACCCGTCTGGTGGTGGG + Intergenic
904961386 1:34335964-34335986 ACAAGGACCCAGGTAAAGGTTGG - Intergenic
905281669 1:36853306-36853328 ACAAAGGCCCATGGGGTGGATGG - Intronic
906729238 1:48066914-48066936 AGAAGGACCCCATTGGTGGTGGG - Intergenic
910587701 1:88897512-88897534 ACAAGGACACTTGTGTTTGTCGG + Intergenic
911471753 1:98327745-98327767 ATAAGGAGCTTTGTGGTGGTGGG + Intergenic
915025447 1:152825792-152825814 ATAAGGTACCAGGTGGTGGTAGG + Intergenic
917024497 1:170627408-170627430 ACCAGGGCCCTTTTGGTGGTGGG - Intergenic
917729326 1:177858467-177858489 ACAGGGACCCATCAGTTGGTAGG + Intergenic
919452631 1:197788897-197788919 ACAAGGACCAGTGTGGAGCTTGG - Intergenic
920007560 1:202844581-202844603 ACATAGAGACATGTGGTGGTCGG + Intergenic
1065243078 10:23727802-23727824 ACAAGGGCCCATCGGGAGGTGGG - Intronic
1066246012 10:33584009-33584031 ACAAGTTACCATTTGGTGGTTGG - Intergenic
1067877465 10:50018754-50018776 GAAAGGACCCCTGTGGGGGTGGG + Intergenic
1067956642 10:50798217-50798239 AGAAGAACCCATCAGGTGGTTGG + Intronic
1071119129 10:82257616-82257638 AAAATTAGCCATGTGGTGGTGGG + Intronic
1074714350 10:116204237-116204259 AGAATGATCCATGTGGTGATGGG + Intronic
1077333799 11:1994581-1994603 ACAAGGAGCCAGGGGGTTGTGGG - Intergenic
1083692677 11:64419764-64419786 ACAAGGACCCAAGTGGAGAAGGG - Intergenic
1086087222 11:82967577-82967599 ACACCCAACCATGTGGTGGTTGG - Intronic
1088360938 11:108989458-108989480 ACCAGGGCCCATTGGGTGGTGGG - Intergenic
1091374597 12:17418-17440 ACAAAGACCCATGTGATGCTGGG - Intergenic
1092527051 12:9315714-9315736 ACAAAGAGCCATGTGATGCTGGG - Intergenic
1092540216 12:9416058-9416080 ACAAAGAGCCATGTGATGCTGGG + Intergenic
1094512824 12:31106398-31106420 ACAAAGACCCATGTGATGCTGGG - Intergenic
1098635831 12:72782122-72782144 ACATGGACACAGGTGGGGGTGGG + Intergenic
1102900406 12:116632276-116632298 TCGAGAACCCATGTGCTGGTGGG + Intergenic
1108149071 13:47512640-47512662 ACAAGTACGCATGTGGAAGTGGG + Intergenic
1113722520 13:112570308-112570330 ACAAAGACCCGTGTGCTTGTTGG - Intronic
1118555580 14:67016188-67016210 CCATGGACCCATGTGGTACTTGG + Intronic
1119643901 14:76334896-76334918 ACAGGGAGCCACGTGGTGATGGG + Intronic
1121426408 14:93855216-93855238 AAAATTAGCCATGTGGTGGTAGG + Intergenic
1122051792 14:99065798-99065820 ACAAGGACTCCTGTGTTGGGTGG - Intergenic
1123068729 14:105630730-105630752 GCAAGGACGGATGTGGAGGTGGG + Intergenic
1123104813 14:105836035-105836057 GCAAGGACCCAGGTATTGGTCGG - Intergenic
1125185169 15:36921800-36921822 ACAAAGACTCAAGTGCTGGTTGG + Intronic
1127296178 15:57610550-57610572 TCATGAACCCCTGTGGTGGTTGG + Intronic
1127384099 15:58453285-58453307 TCTAGGTCCCATGTGGTGCTGGG - Intronic
1129616628 15:77104072-77104094 ACAAAGACTCGTATGGTGGTGGG + Exonic
1129835758 15:78704422-78704444 AGAAGGTGCCATGAGGTGGTGGG + Intronic
1129960680 15:79681573-79681595 ACAAGGCCCCAGGTGCTGGCCGG - Intergenic
1131878614 15:96838450-96838472 ACAAGGACCAATATAGTGGTAGG + Intergenic
1132451998 15:101973635-101973657 ACAAAGACCCATGTGATGCTGGG + Intergenic
1132454897 16:16986-17008 ACAAAGACCCATGTGATGCTGGG - Exonic
1135406046 16:22198688-22198710 ATAAGAACCCTTGTGGTGGCTGG - Intergenic
1135489687 16:22898738-22898760 ACAACTACCCATGTGGTTTTAGG + Intronic
1137720241 16:50623417-50623439 ACAAGGACCCAGGTGGGCTTAGG - Intronic
1140531330 16:75669160-75669182 ACAAAGCCCAGTGTGGTGGTGGG + Intronic
1142000432 16:87661220-87661242 ACAAGGACCCTTGTGGTTCGGGG + Intronic
1144215618 17:13052549-13052571 ACATGGACAGATCTGGTGGTTGG - Intergenic
1145177826 17:20717075-20717097 ACAAGTTCCTATGAGGTGGTAGG - Intergenic
1149043530 17:52218554-52218576 TCAAGGGCCCTTGTGGTGGCTGG + Intergenic
1150616321 17:66775202-66775224 GCAAAGTCCCATGTGGGGGTGGG + Intronic
1151134865 17:71936862-71936884 AAAAGGCCACAGGTGGTGGTGGG - Intergenic
1153399429 18:4667011-4667033 ACATGCACACATGTGCTGGTGGG - Intergenic
1157212990 18:45759779-45759801 CCAAGGGGCCATGTTGTGGTGGG + Intergenic
1157293057 18:46423587-46423609 ATGAGGACCCATGTGCTGGAAGG + Intronic
1161550203 19:4908671-4908693 ACCAGCAGCCATGTGGTGGGAGG - Intronic
1162898235 19:13778234-13778256 GCAAGGTCCCATATGGAGGTAGG - Exonic
1163503373 19:17688909-17688931 GCAAGGACCCATGGGCTGGATGG - Intergenic
1164506719 19:28867144-28867166 ACTAGGACCCACGTGGTGCATGG + Intergenic
1166554113 19:43686717-43686739 TCAAGGTCACATGTGGTGTTGGG + Intergenic
927808130 2:26166256-26166278 ACAAGGACTAATGTGGTGCCTGG - Intergenic
929256398 2:39815683-39815705 ACATGAACACATGGGGTGGTGGG + Intergenic
931641841 2:64387340-64387362 AAAATGAACCTTGTGGTGGTTGG + Intergenic
932068867 2:68595810-68595832 ACATGGACACATGGGGTGGGTGG - Intronic
933420648 2:82041845-82041867 ACAGGTTCCCATGTGGTGCTAGG - Intergenic
934655157 2:96113455-96113477 ACAAGGACTCATTTGGGGCTTGG + Exonic
935707530 2:105870020-105870042 ACAAGGACCCATGTGGTGGTCGG + Intronic
936071469 2:109374427-109374449 ACCAGGATCCATGTGGTGTGTGG - Intronic
936568213 2:113596111-113596133 ACAAAGACCCATGTGATGCTGGG + Intergenic
938807631 2:134821539-134821561 TCAAGGACCCATGGAGTGATGGG - Intergenic
939363188 2:141200341-141200363 ACATGGACACATGAGGTGGAGGG + Intronic
943492134 2:188567624-188567646 ACCAGGACCCATTAGGGGGTGGG + Intronic
945651636 2:212568505-212568527 ACAAGGACACATGATGTAGTGGG - Intergenic
946634959 2:221714511-221714533 AGAAGGTCAGATGTGGTGGTGGG - Intergenic
1169505599 20:6208208-6208230 GCAAGCACATATGTGGTGGTGGG + Intergenic
1174003248 20:47390152-47390174 ACAAGGCCACATGTGGATGTGGG - Intergenic
1175287431 20:57846297-57846319 ACAAGGACCTCTGTGGCTGTGGG - Intergenic
1180057569 21:45366874-45366896 CCAAGGACCCGTGAGGTGGCCGG - Intergenic
1182276231 22:29190401-29190423 ACATGGACCTATGTTTTGGTGGG - Intergenic
1183340884 22:37280696-37280718 ACAAGAACCCAGGTGGAGGCAGG + Intergenic
1183443899 22:37840139-37840161 ACAGGGTCCCATGGGCTGGTTGG - Intronic
1184355824 22:43978979-43979001 ACAAGGAGGCCTGTGGTGGCAGG - Intronic
1184682671 22:46080401-46080423 GCCAGGAGCCATGTGGTGCTGGG - Intronic
1184897625 22:47420753-47420775 ACAAGGACCCAGGAGGGTGTTGG - Intergenic
1185158686 22:49209495-49209517 AGAAGGCCTCATGTGGTGGCAGG - Intergenic
949530135 3:4947506-4947528 ACAAGGAGACATTTGGTGGAGGG - Intergenic
951169723 3:19526989-19527011 ATAAGGACCAATGTGGAGCTGGG - Intronic
953882345 3:46697126-46697148 AAAAAAACCCATGTGGTGTTAGG + Intergenic
954626012 3:52022257-52022279 ACCATGAGCCATGTGGTGCTGGG - Intergenic
955271068 3:57499975-57499997 ACAAGGTCCCTTGAGGAGGTAGG + Intronic
959179777 3:102963310-102963332 ACATGGATCCATATTGTGGTGGG + Intergenic
960863469 3:122176591-122176613 ACATGGACACATGGGGTGGCAGG + Intergenic
961165575 3:124761265-124761287 AAAATGACCCATCTGGGGGTGGG + Intergenic
962531368 3:136283880-136283902 TCATGGGCCCATGTGCTGGTGGG + Exonic
962971929 3:140409096-140409118 GCATGCACTCATGTGGTGGTGGG - Intronic
963063464 3:141243231-141243253 ACAAGGACCCAGGAGGTTGGAGG + Intronic
966093241 3:176165861-176165883 ACTAGGAAACAGGTGGTGGTTGG - Intergenic
968337342 3:197925147-197925169 ACAAGGCCCCCTGTGGGGGAGGG + Intronic
984894247 4:184522582-184522604 ACATGGACACATGGGGTGGGGGG - Intergenic
985327967 4:188794602-188794624 ACAATGACCCATCTTGTGGTTGG - Intergenic
986688920 5:10297844-10297866 ACACAGACACAGGTGGTGGTGGG + Intronic
988868226 5:35359036-35359058 ACAAGGAGCCATGTAGTATTTGG - Intergenic
996995198 5:129687204-129687226 ACAAGCGCCCATCTTGTGGTTGG + Intronic
999008436 5:148007518-148007540 CCGAGGACACCTGTGGTGGTGGG + Intergenic
1000321873 5:160140785-160140807 ACACGAACAGATGTGGTGGTGGG + Intergenic
1001845157 5:174915836-174915858 AGAAGGTGCCATGAGGTGGTGGG - Intergenic
1005456382 6:26023663-26023685 AGAAGGCCCAAGGTGGTGGTGGG - Intergenic
1014007221 6:116433471-116433493 AGAAGGAACCGTGTGGTGGAAGG + Exonic
1020458109 7:8397186-8397208 ACAAAGAGCCAGGGGGTGGTTGG - Intergenic
1021618000 7:22522228-22522250 AAAAGGACATAAGTGGTGGTTGG - Intronic
1022927591 7:35071708-35071730 AAAAGGACATAAGTGGTGGTTGG - Intergenic
1026612387 7:71871638-71871660 AGGAGGAGCCATCTGGTGGTGGG - Intronic
1027706491 7:81540337-81540359 ACAAGGAGGCATATGGTTGTGGG + Intergenic
1028374677 7:90133880-90133902 AAAAGGACATAAGTGGTGGTTGG + Intergenic
1029510650 7:100992748-100992770 ACAAGGGCAGATGTGGTGCTAGG - Exonic
1029511139 7:100995997-100996019 ACAAGGGCAGATGTGGTGCTAGG - Exonic
1029511867 7:101000668-101000690 ACAAGGGCAGATGTGGTGCTAGG - Exonic
1029512359 7:101003917-101003939 ACAAGGGCAGATGTGGTGCTAGG - Exonic
1029512440 7:101004496-101004518 ACAAGGGCAGATGTGGTGCTAGG - Exonic
1032397695 7:131602448-131602470 AGGGGGACCCATGTGGTGGTTGG - Intergenic
1034346674 7:150389478-150389500 CCAAGGAGCCAGGTGGTGGCAGG + Intronic
1035735013 8:1881522-1881544 ACATGGTCCCATGTGGGGTTGGG + Intronic
1037264360 8:17041687-17041709 ATAAGGACCCAGGTGGGAGTAGG + Intronic
1037800053 8:22028075-22028097 ACAGGGGACCATGTGATGGTAGG - Intronic
1039472408 8:37821652-37821674 ACACAGACCCATGTGCTGGCAGG - Intronic
1040891248 8:52318876-52318898 ACATGGACACATGGGGGGGTGGG + Intronic
1049884318 9:17414-17436 ACAAAGACCCATGTGATGCTGGG - Intergenic
1052545189 9:29867637-29867659 ACTAGGACCCAGGTAGGGGTGGG - Intergenic
1053298989 9:36935518-36935540 ACAGGTTCCCAAGTGGTGGTGGG + Intronic
1055960808 9:81818440-81818462 ACAAGGACGTGTGTGGTTGTAGG + Intergenic
1056685879 9:88758923-88758945 ACAACGAGCCATGCGGAGGTAGG - Intergenic
1056765349 9:89441628-89441650 AGGAGGAGCCATGGGGTGGTGGG - Intronic
1056881404 9:90397088-90397110 ACAAGGATCAAAGTGGGGGTGGG + Intergenic
1057258425 9:93569190-93569212 ACAAGGACCAAGGTAGTGTTAGG + Intergenic
1059434275 9:114266855-114266877 ACCAGGACCCTTGTGGGGGTTGG + Intronic
1060050754 9:120376541-120376563 ACAAGTAGGCAGGTGGTGGTAGG - Intergenic
1187246178 X:17554634-17554656 ACAAGGAACTGTGTCGTGGTTGG + Intronic
1188389559 X:29602980-29603002 ACAAGGCCAGGTGTGGTGGTGGG + Intronic
1190620344 X:52281164-52281186 ACAAGGACCAAACTGGTGTTAGG - Intergenic
1192407050 X:70896855-70896877 ACCAGGGCCCATCAGGTGGTGGG + Intronic
1198314201 X:135450369-135450391 GCAGGTACTCATGTGGTGGTGGG - Intergenic
1200401487 X:156022742-156022764 ACAAAGACCCATGTGATGCTGGG + Intergenic