ID: 935708202

View in Genome Browser
Species Human (GRCh38)
Location 2:105874358-105874380
Sequence ATGGAGATAAGATCTGATTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 214}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935708202_935708204 26 Left 935708202 2:105874358-105874380 CCATAATCAGATCTTATCTCCAT 0: 1
1: 0
2: 0
3: 16
4: 214
Right 935708204 2:105874407-105874429 ATTTAGCTGACTTTAATAATAGG 0: 1
1: 0
2: 1
3: 18
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935708202 Original CRISPR ATGGAGATAAGATCTGATTA TGG (reversed) Intronic
901127083 1:6937190-6937212 ATGGTGATAAGTGATGATTATGG - Intronic
903584421 1:24400361-24400383 AGGGAGATAATATCTGAGAAGGG + Intronic
903900395 1:26640538-26640560 ATGGAGATAGGCTTTGATAATGG - Intergenic
903901275 1:26647500-26647522 ATGGAGATAGGCTTTGATAATGG + Intergenic
905630731 1:39516831-39516853 ATGGAGATAAAAACTGACGAGGG + Intronic
905667029 1:39769339-39769361 ATGGAGATAAAAACTGACGAGGG - Intronic
906957720 1:50389446-50389468 GTGAAGATAATATCTCATTATGG + Intergenic
908796970 1:67839928-67839950 ATGGAGACAAGAAGAGATTAAGG - Intergenic
911262289 1:95701268-95701290 ATGGAGATAAACTCTGCTTAGGG + Intergenic
912389893 1:109295713-109295735 ATGGAGATAACATCTCAGAAGGG - Intronic
912516405 1:110219269-110219291 ATGGAGATAAGAGTTGAGGAGGG - Intronic
912524644 1:110272184-110272206 ATTGAGACAGGATCTGATTCTGG - Intronic
912703199 1:111893821-111893843 ATGGGGATAAGGTCAGATTTGGG + Intronic
914372805 1:147044726-147044748 ATGGAAAGAAGATCTCATAAAGG - Intergenic
914741080 1:150465543-150465565 AAGGTGAAAAGATCTGCTTATGG + Intronic
915932937 1:160070946-160070968 AAAGAGGTAACATCTGATTAGGG + Intergenic
918612469 1:186508643-186508665 ATGGAGATAATATGTGGTTTTGG + Intergenic
918846960 1:189628319-189628341 ATGGACATTAAATATGATTATGG + Intergenic
921233735 1:213101582-213101604 ATAGAAATAAGATCTTTTTAGGG + Intronic
921257202 1:213353341-213353363 AAGGAGCTAAGATATGTTTAGGG - Intergenic
921732385 1:218592979-218593001 ATGGTGATAACATCTGCTTCTGG + Intergenic
921993270 1:221390408-221390430 ATGGAGATCATATATGAATAAGG - Intergenic
923435762 1:233966329-233966351 ATTGAGATTAAGTCTGATTAGGG - Intronic
923435799 1:233966509-233966531 ATCCAGATTAGGTCTGATTAGGG - Intronic
924401749 1:243690684-243690706 ATGGTGATGAGACCTGATTTGGG - Intronic
1064075565 10:12265931-12265953 AGGGAGATAAGAACTGGGTAAGG - Intergenic
1065807524 10:29408810-29408832 AAGGAGATAAGACAAGATTACGG + Intergenic
1070163186 10:73878325-73878347 CTGGAGAGAAGATGTGATCATGG + Intergenic
1071111021 10:82156657-82156679 TTGGAGCTAAAATCTGATGAAGG - Intronic
1071711353 10:88052983-88053005 ATGGAGATAACATCTGTCTTAGG - Intergenic
1073594727 10:104788374-104788396 ATGGAGATCAGTCCTGATCAGGG - Intronic
1073962148 10:108944667-108944689 ATGGAAATAACATCTGAAGAGGG - Intergenic
1076232147 10:128829798-128829820 ATGAACATAAGATATGATGAAGG + Intergenic
1079284749 11:19118147-19118169 ATGGGGATAATATCTTCTTAAGG - Intronic
1085168869 11:74430715-74430737 ACGAAGATAAAATATGATTAAGG - Intergenic
1085229434 11:74952013-74952035 AAGTAGATAGCATCTGATTAGGG + Intronic
1087683985 11:101243004-101243026 ATGGAGATAACACCTGGTTGAGG + Intergenic
1090133779 11:124173312-124173334 ATAAAAATAAGATATGATTATGG - Intergenic
1091136947 11:133200089-133200111 ATGGAGATAGGAGCTGTGTAGGG - Intronic
1094237290 12:28183553-28183575 TTGGAGATGAGATCTGGGTAGGG - Intronic
1095201480 12:39389620-39389642 ATGGAAAAGATATCTGATTACGG - Intronic
1095351726 12:41221705-41221727 CAGGAGAAAAAATCTGATTAAGG + Intronic
1097015972 12:55987480-55987502 AGAGATATAAGACCTGATTATGG + Intronic
1098141411 12:67453632-67453654 AAGCAGAAAAGATTTGATTAGGG - Intergenic
1098720541 12:73892078-73892100 AGGGAGACAAGATCTGATATAGG - Intergenic
1100802603 12:98249255-98249277 ATGATGAGAAGATCTGATTTCGG + Intergenic
1106270024 13:28144076-28144098 AAGGTGGTAAGCTCTGATTAAGG + Intronic
1106502006 13:30337860-30337882 ATGGAGATAAGAAATGTTTTAGG + Intergenic
1106968081 13:35098183-35098205 ATAGAGATGAGATTTGAATATGG + Intronic
1110588586 13:77225780-77225802 ACAGAGATAAGATCTGGTTATGG + Intronic
1111170322 13:84518678-84518700 ATTGAGATAAGAGATGATTAGGG + Intergenic
1112150955 13:96763093-96763115 TTGGAGATAAAATCTGAGTCAGG + Intronic
1113080807 13:106517817-106517839 ATGGTGAAAAGATCTGATATTGG + Intronic
1114066628 14:19064895-19064917 AGTGAGATAAGATCTGAGTGTGG + Intergenic
1114095638 14:19335128-19335150 AGTGAGATAAGATCTGAGTGTGG - Intergenic
1114128575 14:19761104-19761126 ATGGTGAGAAGATATGATCAGGG - Intronic
1115097490 14:29654961-29654983 ATGGAAATAAGATGTGTTTTCGG - Intronic
1115900052 14:38135964-38135986 ATGGAAATAAAAAATGATTATGG - Intergenic
1116120290 14:40714411-40714433 ATGGAGATATGTTCTGAGTAAGG - Intergenic
1116546181 14:46167787-46167809 AGTGAGATAATATCTCATTATGG + Intergenic
1117211066 14:53500632-53500654 ATGGAGCCAAGGTCTCATTAAGG + Intergenic
1120604820 14:86561586-86561608 ATGGAGATAAATTGTCATTAAGG + Intergenic
1120735134 14:88044312-88044334 TTGGAGATATGGTCTGATTGAGG + Intergenic
1121424317 14:93837575-93837597 ATGGAGATAAGATTTCCTTCTGG - Intergenic
1121871584 14:97413050-97413072 AATGAGATCAGATCTGATCAGGG + Intergenic
1123184486 14:106503414-106503436 AGGGAGAGGAGATGTGATTATGG - Intergenic
1123484828 15:20681310-20681332 ATAGAGATTAGATTTGAATATGG - Intergenic
1123537559 15:21250381-21250403 ATAGAGATTAGATTTGAATATGG - Intergenic
1123571517 15:21615361-21615383 ATGGTGAGAAGATATGATCAGGG - Intergenic
1123608136 15:22057952-22057974 ATGGTGAGAAGATATGATCAGGG - Intergenic
1124052497 15:26210752-26210774 ATGGACATAAGATCTGAGACTGG + Intergenic
1128920280 15:71603931-71603953 ATGGAGAGAAGAACTGAATATGG + Intronic
1130669268 15:85896142-85896164 ATGGAGATAATATTAGCTTACGG + Intergenic
1130829456 15:87584560-87584582 ATGAATATAAGACCTGATAAAGG - Intergenic
1202980371 15_KI270727v1_random:349750-349772 ATGGTGAGAAGATATGATCAGGG - Intergenic
1133187173 16:4108339-4108361 ATGAAGAAACGGTCTGATTAAGG - Intronic
1133815159 16:9191647-9191669 ATGGTGATGATATCTGATGATGG + Intergenic
1135817643 16:25650305-25650327 ATGGAGATAAAATCAGATTTTGG + Intergenic
1137510552 16:49095984-49096006 ATCGAGCTGAGATCTGATTAGGG - Intergenic
1139389714 16:66599449-66599471 ATGGAGACATGATCTCATTGTGG + Intergenic
1141887800 16:86904698-86904720 ATGGAGATAACATTTTATAAGGG + Intergenic
1144674479 17:17153123-17153145 ATGGATATGAGAACTGATGAAGG + Intronic
1149150136 17:53551956-53551978 AGGGAGATAAAATCTGAGTATGG + Intergenic
1150130842 17:62667920-62667942 ATGGAAATAACATTTGATTTGGG + Intronic
1150516819 17:65821379-65821401 AAGGAAATAAAATCTGTTTAAGG + Intronic
1154998103 18:21660503-21660525 ATGTAGATTAGACATGATTATGG - Intronic
1156561592 18:38131674-38131696 AGGGAAATAAGATCTTATCAAGG + Intergenic
1156612376 18:38740153-38740175 ATGGAGATATGATTTAACTATGG - Intergenic
1157343291 18:46799869-46799891 TTGGAAATATTATCTGATTATGG - Intergenic
1160570523 18:79814543-79814565 ATAGAGATGAGAGCAGATTAGGG + Intergenic
1164616807 19:29672074-29672096 ATGGAGCTAAGAACTGAGCAGGG + Intronic
1167678216 19:50902396-50902418 AAGTAGATTAGACCTGATTAAGG - Intergenic
1168050589 19:53826776-53826798 ATGGAGATAATGCCTGAGTAAGG + Intergenic
926706751 2:15842829-15842851 CTGGAGATCTGATTTGATTAAGG + Intergenic
927123554 2:19991203-19991225 ATTGAGGGAAGATCTGATTTTGG - Intergenic
932996619 2:76862933-76862955 CTGGAAATAAGATCTGCTTTGGG - Intronic
933860046 2:86457525-86457547 ATGGAGATAATATAAGTTTATGG + Intronic
934538536 2:95156824-95156846 AGGGAGATAACATCTGAACAGGG + Intronic
935232737 2:101113145-101113167 ATTGAGATTAGACCTTATTAGGG - Intronic
935708202 2:105874358-105874380 ATGGAGATAAGATCTGATTATGG - Intronic
937384535 2:121416296-121416318 ATGGTGATAATTTTTGATTAAGG - Intronic
938484020 2:131685021-131685043 AGTGAGATAAGATCTGAGTGTGG + Intergenic
939360777 2:141169725-141169747 ATGGAGACAAGATATGAGAACGG + Intronic
939581840 2:143959469-143959491 GTGGAGATAATATCTGATCCTGG + Intronic
939619649 2:144402886-144402908 ATGGTGATAAGACTAGATTATGG - Intronic
940529477 2:154862331-154862353 ATGGAGATAGGTTCTAATTTGGG - Intergenic
941082753 2:161080777-161080799 ATGGTGTTAAGAGGTGATTAGGG - Intergenic
943108634 2:183578893-183578915 AAGGAGAGAAGTTCTGATTTGGG - Intergenic
944594960 2:201252945-201252967 ATGGAGAAAATATCTGTTTCAGG + Intronic
946152248 2:217784548-217784570 AAAGAGATAATATCTGATTTAGG - Intergenic
948287726 2:236799459-236799481 ATGGAGAGCATTTCTGATTATGG + Intergenic
1168875642 20:1170514-1170536 ATGGGGATAACACCTCATTATGG - Intronic
1176409276 21:6439143-6439165 ATGGAGATAAGATCTAGACATGG - Intergenic
1176703375 21:10086787-10086809 ATGGAAATAAGACTTGATTTGGG + Intergenic
1179684771 21:43047465-43047487 ATGGAGATAAGATCTAGACATGG - Intergenic
1180485109 22:15787484-15787506 AGTGAGATAAGATCTGAGTGTGG + Intergenic
1183029792 22:35094888-35094910 AGGGAGCTAAGTTCTGACTAAGG + Intergenic
949767568 3:7543937-7543959 ATAGTGAAAAGCTCTGATTAAGG - Intronic
950991339 3:17441403-17441425 ATGAAGGTAATATCTGATTTTGG + Intronic
951054727 3:18134510-18134532 ATGGAGATAAATTCTTATCAAGG + Intronic
952258209 3:31713695-31713717 CTGGAGTTAAGATCTGAGTGAGG - Intronic
956261540 3:67348813-67348835 CTGGAGAAATGATCTCATTATGG + Intergenic
956605404 3:71068373-71068395 ATGGAGATAAGATGTATTAAAGG + Intronic
957438137 3:80206354-80206376 ATGGAGATAACATCTAATTGTGG + Intergenic
957684888 3:83490071-83490093 ATGGAGATAATATCTAATATAGG + Intergenic
957993809 3:87662228-87662250 AGTGAGATAAGATCTCATTATGG - Intergenic
962085480 3:132187095-132187117 ATGGAGATTATATCTATTTATGG + Intronic
962757433 3:138476457-138476479 ATCAAAAGAAGATCTGATTAAGG + Exonic
963290579 3:143483053-143483075 ATGCAGTTAAGAGTTGATTAGGG - Intronic
963451564 3:145488466-145488488 CTGGAGAAAAGATCAGATTAAGG - Intergenic
963453308 3:145513156-145513178 ATGCTGATAAAATCTGATTCTGG - Intergenic
963472362 3:145756481-145756503 ATGAAGATAAGATCAGTTTGAGG + Intergenic
965810779 3:172589909-172589931 GTGGAGATAAGATTTGGGTAGGG - Intergenic
965949626 3:174291784-174291806 ATGGATATAAGGACTGATAATGG + Intergenic
967357279 3:188586329-188586351 ATGGTAATGAGATATGATTATGG + Intronic
968179786 3:196584347-196584369 ATGGAGGAGAGATCTGCTTATGG + Exonic
970409815 4:15793718-15793740 ATTCAGATAAGATTTGATTTTGG + Intronic
970508565 4:16757415-16757437 ATGGAGATAAGATCTTAAACAGG + Intronic
973132038 4:46659709-46659731 AAGGAGTTAAGAACTGTTTATGG + Intergenic
973329621 4:48899643-48899665 GCAGAGATAATATCTGATTAAGG - Intronic
973720075 4:53714507-53714529 ATGCAGAGAAGCTCTGATTTAGG - Intronic
975647575 4:76560491-76560513 ATGGAGAAAAGATCAGAATTGGG - Intronic
976268505 4:83207263-83207285 ATGGGGATTAGATCTTATAACGG + Intergenic
976444564 4:85116004-85116026 CAGGAGATAAGATCAGATCAGGG - Intergenic
977262353 4:94813155-94813177 ATGGAGTTTATATTTGATTAAGG + Intronic
977677520 4:99764331-99764353 ATCGAGATAAGATTTGGGTAGGG - Intergenic
977708924 4:100102153-100102175 ATAGAGATAAGGTCTCACTAAGG + Intergenic
978262065 4:106772206-106772228 ATGGAGAAAAGTTGTAATTATGG - Intergenic
979589127 4:122458189-122458211 ATGAAGAAAAGGTCAGATTAGGG + Intergenic
980375597 4:131943153-131943175 ATGGAAATAAGACTTGATTTGGG + Intergenic
981107896 4:140902141-140902163 AGGGAGATAAGAGCTGATAAGGG + Intronic
981304417 4:143231315-143231337 ATGGAGATATGAATTGTTTAAGG - Intergenic
981959547 4:150519994-150520016 ATGGACAAAAGATTTGATTAGGG - Intronic
983771967 4:171562044-171562066 ATGGAAATAATATATGAATAAGG + Intergenic
986505288 5:8443351-8443373 TTGGAGATGAGATTTGAGTAGGG + Intergenic
989395165 5:40947503-40947525 TTGGAGATGAGAGCTGATGAAGG + Intronic
992308796 5:75472705-75472727 CAGGAGATAATATCTCATTATGG - Intronic
992729653 5:79649608-79649630 ATGAAGATAAAATCTAGTTAAGG - Intronic
993923129 5:93831804-93831826 ATGGAGATAATATCTGTTAATGG + Intronic
994184731 5:96805293-96805315 ATGGTGATAAGATCGGGGTATGG + Intronic
994803121 5:104405630-104405652 ATGTAGATAATATCTTATCATGG - Intergenic
994992208 5:107011155-107011177 ACGGAGATGAGATTTGAGTAAGG + Intergenic
996127710 5:119745413-119745435 ATCAAGATAACATCTAATTAGGG - Intergenic
996447831 5:123577208-123577230 TTGGAGAAAAGGACTGATTATGG - Intronic
997825402 5:137102241-137102263 CTGGATATAAGATTTCATTAAGG + Intronic
999678253 5:154028895-154028917 ATGGTGGGGAGATCTGATTACGG + Intronic
1000283599 5:159805391-159805413 AGGGAGATAAATTCTGATTCTGG - Intergenic
1001459238 5:171894860-171894882 ATGTATATAAGTTCTCATTATGG + Intronic
1001504694 5:172268828-172268850 ATGCTGATAAGATCTGATTTTGG + Intronic
1001748177 5:174108044-174108066 CTGGAGAGAAGAGCTGATTTTGG + Exonic
1003522499 6:6870103-6870125 CTAAAGATAAGATCTGACTATGG + Intergenic
1005346803 6:24898415-24898437 CTGCAGACAAAATCTGATTATGG + Intronic
1005527202 6:26662601-26662623 AATGTGATAAGATCTGATTATGG + Intergenic
1007354133 6:41298241-41298263 ATGGGGCTAACATCTGATTCTGG - Intergenic
1007969837 6:46040327-46040349 ATGGTGATAATAGCTGATCATGG + Intronic
1009675849 6:66820209-66820231 ATAGAGATAAGGTCTGGCTATGG + Intergenic
1010488327 6:76443500-76443522 ATAGAAAGAAAATCTGATTAAGG - Intergenic
1010760551 6:79717564-79717586 ATGGAGATCAGAGATGCTTAAGG + Intergenic
1011773878 6:90706872-90706894 ATGGAGATGAGGCTTGATTAAGG + Intergenic
1013250870 6:108331956-108331978 TTGGAAATAAGTTCTCATTAGGG - Intronic
1014069023 6:117159956-117159978 ATAGAGACAAGGTCTCATTATGG - Intergenic
1014117616 6:117683841-117683863 ATGCAGATAAGATTTGCTGATGG + Intronic
1014833328 6:126128076-126128098 ATGTGGATATGATCTGTTTATGG + Intergenic
1015239416 6:131006951-131006973 AAGGAGTTAAGATGTGATTGGGG - Intronic
1019290989 7:250089-250111 ATGCAGATAAAATCCAATTAGGG + Intronic
1024393050 7:48836999-48837021 ATGGAGATGAGTTTTGAATAGGG - Intergenic
1027543725 7:79500314-79500336 ATGGTGACAGCATCTGATTATGG - Intergenic
1030182225 7:106721947-106721969 CTGGAGATAAGATATGAGAAAGG + Intergenic
1031702675 7:124944667-124944689 ATGTAGATAAGATCTATTTTTGG - Intergenic
1032994828 7:137433337-137433359 ATGATGATAAGATATGTTTAGGG + Intronic
1033619049 7:143045925-143045947 ATGGAGATAGGAGCTGAATTAGG - Intergenic
1035656604 8:1312497-1312519 ATGGAGACAAGAACAGATTCAGG + Intergenic
1037269354 8:17109146-17109168 ATGGAAATAAAAACAGATTAAGG - Intronic
1037577246 8:20219068-20219090 ATGGAAATAAAAACTGAATAGGG - Intronic
1039993285 8:42508293-42508315 ATGGAGATAGGGTCTCAATATGG - Intronic
1041669928 8:60481701-60481723 ATAGAGATAAGGTCTCACTATGG + Intergenic
1042086615 8:65115945-65115967 ATAGAGATGAGAACTGATTTTGG - Intergenic
1043471084 8:80563285-80563307 ATGCAAATCATATCTGATTAAGG - Intergenic
1044582567 8:93836678-93836700 ATGGAGAAATGATCTAATTTAGG + Intergenic
1048382211 8:133875726-133875748 TTTGAGATAATATCTCATTATGG + Intergenic
1049393652 8:142385497-142385519 ATGCAGATAAGCCCTGACTATGG + Intronic
1050932787 9:11350658-11350680 ATGGAAAGAGGATCAGATTATGG - Intergenic
1051106987 9:13591646-13591668 ATGTAGATTAGCTCTGATGATGG - Intergenic
1051187073 9:14471600-14471622 ATGTAGATAAGGTCTGGCTAAGG - Intergenic
1051368117 9:16335645-16335667 AAGGTGATAAGATTTGCTTAAGG + Intergenic
1051617859 9:19023661-19023683 ATGGAGATAATATATCTTTAAGG + Intronic
1051694779 9:19756192-19756214 TTGGAGGTAAAATCTGATTTAGG - Intronic
1053387169 9:37702054-37702076 GAGAAGATAAGTTCTGATTAGGG + Intronic
1053590552 9:39510144-39510166 ATGAAGATGATATCTTATTATGG - Intergenic
1053640639 9:40073793-40073815 ATGGAAATAAGACTTGATTTGGG + Intergenic
1053765498 9:41391669-41391691 ATGGAAATAAGACTTGATTTGGG - Intergenic
1053848413 9:42265533-42265555 ATGAAGATGATATCTTATTATGG - Intergenic
1054321328 9:63669785-63669807 ATGGAAATAAGACTTGATTTGGG + Intergenic
1054544111 9:66302828-66302850 ATGGAAATAAGACTTGATTTGGG - Intergenic
1054575750 9:66855145-66855167 ATGAAGATGATATCTTATTATGG + Intergenic
1054709089 9:68492947-68492969 TGGGAGATAAGATCTGAGTTAGG + Intronic
1055656020 9:78451244-78451266 ATGCAGATAATATCTTAATATGG - Intergenic
1058758839 9:108109892-108109914 ATGGCAATAAGAACTGTTTATGG + Intergenic
1059263312 9:113000775-113000797 ATGGAGATAAGCTCTAAGCAGGG + Intergenic
1059776340 9:117479160-117479182 ATGGAAATATGATCTCATTTAGG + Intergenic
1202788411 9_KI270719v1_random:56892-56914 ATGGAAATAAGACTTGATTTGGG + Intergenic
1188496245 X:30785964-30785986 ATGAAAATAAAATCTGAATATGG - Intergenic
1190438697 X:50454175-50454197 AAGGAGATAAGAATTGATTGGGG - Intronic
1191081338 X:56513397-56513419 CTGGAGATGATATCTCATTATGG - Intergenic
1192499248 X:71638417-71638439 CTGGAGATAAGATCTGGGAAGGG - Intergenic
1193393025 X:80951655-80951677 ATGGAGAACAGATCTGACAAGGG + Intergenic
1193730869 X:85101278-85101300 TTGGAAATAACATCTGATAAGGG + Intronic
1198219010 X:134582689-134582711 TTGGAGATAAGAAGTGATTTGGG + Intronic
1198813381 X:140559782-140559804 AGGGAGATAATATCTCATTGTGG + Intergenic
1199494474 X:148437797-148437819 AAGGAGAAGAGAGCTGATTATGG + Intergenic
1201509420 Y:14741956-14741978 ATGGAGATAAGTGCTGAAAAAGG + Intronic