ID: 935708585

View in Genome Browser
Species Human (GRCh38)
Location 2:105877555-105877577
Sequence CTGTGTCTCCAGATGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1360
Summary {0: 1, 1: 0, 2: 8, 3: 181, 4: 1170}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935708585_935708592 10 Left 935708585 2:105877555-105877577 CCCTCTTCCATCTGGAGACACAG 0: 1
1: 0
2: 8
3: 181
4: 1170
Right 935708592 2:105877588-105877610 ATTCTGTAGAGAAAGAGAAAAGG 0: 1
1: 0
2: 5
3: 86
4: 886
935708585_935708594 26 Left 935708585 2:105877555-105877577 CCCTCTTCCATCTGGAGACACAG 0: 1
1: 0
2: 8
3: 181
4: 1170
Right 935708594 2:105877604-105877626 GAAAAGGTTTCTCTCTGCTTGGG 0: 1
1: 0
2: 1
3: 17
4: 264
935708585_935708593 25 Left 935708585 2:105877555-105877577 CCCTCTTCCATCTGGAGACACAG 0: 1
1: 0
2: 8
3: 181
4: 1170
Right 935708593 2:105877603-105877625 AGAAAAGGTTTCTCTCTGCTTGG 0: 1
1: 0
2: 4
3: 25
4: 335

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935708585 Original CRISPR CTGTGTCTCCAGATGGAAGA GGG (reversed) Intronic
900437604 1:2639015-2639037 CTGGGTCTCCACATGGTGGAGGG + Intronic
900716365 1:4147618-4147640 CTGTGTCTTGACATGGAAGGCGG + Intergenic
901291395 1:8126928-8126950 CTGTGTCCCCACATGGTGGAAGG - Intergenic
901445225 1:9304306-9304328 CTGGGTCTCCAGCTTGCAGATGG + Intronic
901840843 1:11952992-11953014 CTGTGTCCTCAGATGGTGGAAGG + Intronic
902899753 1:19506778-19506800 CTGTGTCCCCACATGGTGGAAGG + Intergenic
902907804 1:19571826-19571848 CTGTGTCTTCTTATGGTAGAAGG - Intergenic
902967172 1:20014050-20014072 CTGTGTCCTCACATGGCAGAAGG + Intergenic
903129157 1:21267106-21267128 CTGTGTCTTCACATGGCATATGG - Intronic
903150280 1:21403126-21403148 CTGTGTCTTCACATGGCAGAAGG + Intergenic
904096024 1:27978069-27978091 CTGTCTTTGAAGATGGAAGATGG + Intronic
904352854 1:29920271-29920293 CTGTGTCCTCACATGGCAGAAGG - Intergenic
904679273 1:32217459-32217481 CTGTGACTTCATCTGGAAGATGG - Intronic
904712302 1:32439502-32439524 CTGTGTCTCCAGCTTACAGATGG + Intergenic
904861997 1:33545519-33545541 CTGTGTCTTCACATGGCACAAGG + Intronic
905000453 1:34664045-34664067 CTGTGTCCTCACATGGCAGAAGG - Intergenic
905020780 1:34809845-34809867 CTGTGTCTTCACATGGCAGAAGG + Intronic
905142823 1:35861934-35861956 CTGTGGCTGGAGAAGGAAGAAGG + Intergenic
905350178 1:37340117-37340139 CTGTGTCTTCACATGGTGGAAGG - Intergenic
905858484 1:41330599-41330621 CTGTGTCTCCATATGGAGAGGGG - Intergenic
906130201 1:43451303-43451325 CTGTGTCTCCTGCAGGGAGAGGG + Exonic
906173672 1:43749861-43749883 CTGTGTCCTCATATGGCAGAAGG - Intronic
906745663 1:48220698-48220720 CTGTGTCCTCACATGGCAGAAGG + Intergenic
906935565 1:50211346-50211368 CTGTGTCCTCACATGGTAGAAGG + Intergenic
907052636 1:51340023-51340045 CTGTGTCTTCACATGGAGGAAGG - Intronic
907078509 1:51599922-51599944 CTGTGTCCTCACCTGGAAGAAGG + Intronic
907454428 1:54566057-54566079 CTGGCTCTCCAGAGGGAAGGGGG - Intronic
907854806 1:58292190-58292212 CTGGGTCTCCAGCTTGCAGATGG + Intronic
907964166 1:59313130-59313152 CTGTGTCCTCACATGGTAGAAGG + Intronic
907983594 1:59508730-59508752 CTGTGGTTCCAAATGAAAGATGG + Intronic
908076158 1:60521204-60521226 CTGTGTCTTCAGATGGTGAAAGG + Intergenic
908089597 1:60671819-60671841 CTGTGTCTTCACATGGTGGAAGG - Intergenic
908113080 1:60916243-60916265 CTGTGTCTTCACATGGCAGGAGG + Intronic
908158930 1:61386947-61386969 CTGTGTCCTCACATGGCAGAAGG + Intronic
908499475 1:64728910-64728932 CTGTGTCCTCACATGGCAGAAGG - Intergenic
908719403 1:67108298-67108320 CTGTGTCCTCACATGGGAGAAGG + Intronic
908790627 1:67777631-67777653 TTCTGGCTCCTGATGGAAGAGGG + Intronic
908901103 1:68957540-68957562 CTGTGTCCTCACATGGCAGAAGG - Intergenic
909229506 1:73067872-73067894 CTGTGTCTTCACATGGTAGAAGG - Intergenic
909239389 1:73192840-73192862 CTGTGTCCTCACATGGAAGAAGG + Intergenic
909301700 1:74020878-74020900 CTATGTCTTCACATGGCAGAAGG + Intergenic
909454683 1:75837174-75837196 CTGTATCTTCACATGGTAGAAGG - Intronic
909619883 1:77655431-77655453 CTGTGTCTTCACATGGCTGAAGG - Intronic
909681251 1:78294487-78294509 CTGTGGCTTCAGAGGGTAGAAGG + Intergenic
910100549 1:83570856-83570878 CTATGTCTTCACATGGCAGAAGG + Intergenic
910253481 1:85222517-85222539 CTGTGTCCTCACATGGTAGATGG + Intergenic
910544641 1:88400110-88400132 CTGTGTCCTCACATGGTAGAAGG + Intergenic
911160743 1:94680491-94680513 CTGTGTCTTCACATGGCAGAGGG + Intergenic
911378033 1:97075628-97075650 CTGTGTCCTCACATGGTAGAGGG - Intergenic
911441175 1:97927490-97927512 CTGTGTCCTCAGATGGCAGAAGG + Intergenic
911763126 1:101639569-101639591 CTGTGTCTTCTCATGGATGACGG - Intergenic
912050414 1:105522679-105522701 GTGTGTTTCCAGTTGGAAGAAGG - Intergenic
912453050 1:109779136-109779158 CTGTGTCCTCACATGGTAGAAGG + Intergenic
912556225 1:110518074-110518096 CAGTGTCTCCAGGCAGAAGATGG + Exonic
912667607 1:111596736-111596758 CTGTGTCCTCACATGGTAGAAGG + Intronic
912813221 1:112809529-112809551 CTCTGTCTCCAGTTGCCAGAGGG - Intergenic
913050293 1:115111664-115111686 CTGTGTCCTCACATGGTAGAAGG - Intergenic
913148756 1:116018965-116018987 CTGTGTCTATCGATGGATGAAGG - Intronic
913446518 1:118956048-118956070 CTGTGTCCCCATGTGGTAGAAGG - Intronic
913616696 1:120567010-120567032 CTGTGTCTTCACATGGTAGAAGG - Intergenic
914077492 1:144369066-144369088 CTGTGTCCTCACATGGAGGAAGG + Intergenic
914101687 1:144597439-144597461 CTGTGTCCTCACATGGAGGAAGG - Intergenic
914573579 1:148943900-148943922 CTGTGTCTTCACATGGTAGAAGG + Intronic
915027475 1:152844228-152844250 CTGTGTTTACAGATGTAAGTGGG + Intergenic
915405845 1:155659158-155659180 CTGAGTCTCAAGTTGGAAAAGGG + Intergenic
915663147 1:157420250-157420272 CTGTGTCCTCACATGGTAGAAGG - Intergenic
915863388 1:159471778-159471800 CTGTGTCCTCAGTTGGCAGAAGG - Intergenic
916162759 1:161935392-161935414 CTGTGTCTTCAAATGGCAGAAGG - Intronic
916671406 1:167024640-167024662 CTGTGTCCCCACATGGTGGAAGG - Intergenic
916764499 1:167847218-167847240 CTGTGTCTACTAATGTAAGAAGG - Intronic
916784683 1:168077831-168077853 CTTGTTCTCCATATGGAAGAGGG - Intergenic
917652664 1:177094490-177094512 CTGTGTCTCCACATGGTGAAAGG - Intronic
917794819 1:178525730-178525752 ATGTGTCTTCACATGGTAGATGG + Intronic
918007164 1:180552581-180552603 CTCTTTCTCTAGAGGGAAGATGG - Intergenic
918119643 1:181527255-181527277 CTGTGTCCTCACATGGTAGAAGG + Intronic
918153006 1:181814747-181814769 CTGTGTCTTCACATGGCAGAAGG + Intergenic
918334219 1:183491909-183491931 CTGTGTCCACATATGGCAGAAGG + Intronic
918358354 1:183728301-183728323 CTGTGTTTCCAGCTTGCAGATGG + Intronic
918538912 1:185605873-185605895 CTGTGTCTCTACATGGTAGAAGG - Intergenic
918855037 1:189741840-189741862 CTGTGCCTTCACATGGCAGAAGG + Intergenic
918978316 1:191520690-191520712 CTTTCTCTCTAGAAGGAAGAAGG - Intergenic
919067063 1:192705791-192705813 CTGAGTCTCCAGTTTGCAGATGG + Intergenic
919181945 1:194096782-194096804 CTGAGTCTCCAGCTTGCAGATGG + Intergenic
919275718 1:195413870-195413892 CTGTGTCTTCACATGGCAGAAGG + Intergenic
919462446 1:197894006-197894028 CTGTGTCTTCACAAGGCAGAAGG + Intergenic
919754615 1:201059027-201059049 CTGTGTCTGAAGGTGGAAGTGGG + Intronic
920353337 1:205352263-205352285 CTCACTCTCCAGATGGAAGGAGG + Intronic
920396133 1:205647506-205647528 CTGTGTCCTCACATGGCAGAAGG + Intergenic
920569887 1:207008610-207008632 CTCTGTATCCAGAAGGAAGCTGG + Intronic
920724986 1:208426668-208426690 CTGTGTCCTCACATGGAGGAAGG + Intergenic
920724990 1:208426708-208426730 CTGTGTCCTCACATGGTAGAAGG + Intergenic
920744211 1:208610765-208610787 CTGTGTCCTCATGTGGAAGAAGG + Intergenic
920842848 1:209569215-209569237 TTGTCTTTCCAGATGGAATAGGG - Intergenic
920918363 1:210276941-210276963 CTGTGTCTTCATATGGTGGAAGG - Intergenic
922039607 1:221883833-221883855 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
922324972 1:224519420-224519442 CTGAGTCTCCAGCTTGCAGACGG + Intronic
922527059 1:226312081-226312103 CTGTGTCCTCACATGGTAGAAGG + Intergenic
922904724 1:229165224-229165246 CTGTGTCTCTAGATCGCAGGAGG + Intergenic
922978116 1:229801909-229801931 CTGAGTCTCCACATGGTGGAAGG + Intergenic
923280836 1:232441617-232441639 CTGGGTCTCCAGATGCAGGAGGG - Intronic
923319529 1:232816939-232816961 CTGTGTCCTTACATGGAAGAAGG + Intergenic
923390866 1:233513768-233513790 CTGTGTCTTCATGTGGAAGAAGG + Intergenic
923512954 1:234668651-234668673 CTGTGTCTTCACATGGCAGAAGG - Intergenic
923676854 1:236087869-236087891 CTGTGTCCTCACATGGCAGAAGG + Intergenic
923791665 1:237116634-237116656 CTGGGTCTCCAGCTTGCAGATGG - Intronic
923906828 1:238394354-238394376 CTGGGTCTCCAGTTTGCAGAAGG - Intergenic
924012220 1:239677573-239677595 CTGTGTCTTCACATGGCAGAAGG + Intronic
924047537 1:240047274-240047296 CTGTGTCTTCACATGGTGGAAGG - Intronic
924127822 1:240874082-240874104 CTGTGTCCCCACATGGTAGAAGG - Intronic
924187594 1:241511227-241511249 CTGTGTCCTCACATGGTAGAAGG - Intronic
924327661 1:242911875-242911897 TTGTATCTGCAGATGGAGGAAGG - Intergenic
924454283 1:244206068-244206090 CTGTTTCTCCATCTGGAAAATGG + Intergenic
924494866 1:244577595-244577617 CTGTGTCCTCACATGGCAGAAGG + Intronic
924604769 1:245523609-245523631 CTGTGTCTTCACATGGCAGAAGG + Intronic
1063023535 10:2154934-2154956 CTGTGTCCCCACATGGTGGAAGG - Intergenic
1063023557 10:2155023-2155045 CTGTGTCTTCACATGGTGGAAGG - Intergenic
1063034894 10:2276664-2276686 CTGCTTCTCCAGATGGAAGGCGG + Intergenic
1063041132 10:2338374-2338396 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1063073082 10:2686457-2686479 CTGTGTGTCTAGATGCAACATGG + Intergenic
1063108171 10:3012007-3012029 CTGTGTCCTCACATGGTAGATGG - Intergenic
1063192825 10:3713810-3713832 ATGTGTCTTCAGATTGAATAAGG + Intergenic
1063250951 10:4273973-4273995 CTGTGTCTCCAGCTTAAAGATGG + Intergenic
1063483768 10:6400207-6400229 CTGGGGCTACAGATGAAAGAAGG - Intergenic
1063558422 10:7102970-7102992 CTGAGTCACCACCTGGAAGAAGG - Intergenic
1063559131 10:7110215-7110237 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1063565734 10:7171258-7171280 ATGTGCCTTCAGATGGAAGAAGG + Intronic
1063721735 10:8589368-8589390 CAGTTTCTCCATTTGGAAGAAGG + Intergenic
1064551978 10:16511047-16511069 GTGCGTCTCCTGGTGGAAGAGGG + Exonic
1064559411 10:16581328-16581350 CTGTTTCTCTAACTGGAAGAAGG - Intergenic
1064648505 10:17484642-17484664 CTGGGTCTCCAGCTTGCAGAAGG - Intergenic
1064692462 10:17931932-17931954 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
1064735265 10:18375745-18375767 CTGTGTCTACAGTTGAAGGATGG + Intronic
1064741579 10:18440124-18440146 CTGTGTCTTCATGTGGGAGAGGG + Intronic
1064909307 10:20383132-20383154 CTGTTTCTCCAGCTTGTAGATGG + Intergenic
1065228826 10:23575562-23575584 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1065327466 10:24561481-24561503 CTGTGTCCTCACATGGTAGAGGG - Intergenic
1065554344 10:26899984-26900006 CTGGGTCTCCACTTGTAAGATGG + Intergenic
1065731869 10:28716908-28716930 CTGTGTCACCCCATGGAGGAAGG - Intergenic
1065867363 10:29925682-29925704 CTGGGTCTCCAGCTTGCAGAAGG + Intergenic
1065871379 10:29959139-29959161 CTGTATCTTCACATGGCAGAAGG - Intergenic
1065875154 10:29991495-29991517 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
1066020085 10:31289723-31289745 CTGTGTCCTCACATGGCAGATGG - Intergenic
1066174575 10:32890650-32890672 CTGTGTCCTCAGATGGTGGAAGG + Intergenic
1066491518 10:35899328-35899350 CCGTGGCTGCAGATGGAGGATGG + Intergenic
1066630024 10:37450138-37450160 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1067052595 10:43030879-43030901 CTGTGTCTTCACATGGCAGAAGG + Intergenic
1067067966 10:43114255-43114277 CTCTGTCTCCATCTGTAAGAGGG + Intronic
1067074418 10:43166386-43166408 TTGCGTCTCCTGAGGGAAGATGG + Intronic
1067270812 10:44789986-44790008 CTGTGTCTCCAGAAGAGATACGG - Intergenic
1067665916 10:48279123-48279145 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
1067750685 10:48969291-48969313 CTCTGCCTCCAGCTGGAGGAAGG - Intronic
1067846452 10:49725927-49725949 CTGTGTCCTCACATGGCAGATGG - Intergenic
1068153121 10:53160021-53160043 CTGTGTCCTCACATGGTAGAAGG - Intergenic
1068579045 10:58718272-58718294 CTATGTCTTCACATGGTAGAAGG + Intronic
1068659658 10:59611115-59611137 CTGTGTCCTCAGATGGCAGGGGG - Intergenic
1068711661 10:60141518-60141540 CAGTGTACCCAGATGGAAGATGG - Intronic
1068812783 10:61275397-61275419 CTGTGTCTCCAGCTTGCAGAAGG - Intergenic
1069099926 10:64307538-64307560 CTATGTCTCCAAAGGTAAGAAGG + Intergenic
1069644122 10:69979725-69979747 CAGTGTGTCCAGCTTGAAGATGG - Intergenic
1069656366 10:70092163-70092185 CTGTGTCCTCACATGGCAGAAGG - Intronic
1069747549 10:70725559-70725581 CTGTGTCCTCACATGGTAGAAGG + Intronic
1069764273 10:70841511-70841533 CTGTATCTTCACATGGTAGAAGG + Intronic
1069787767 10:71000207-71000229 CTGTGTCCTCATATGGCAGATGG + Intergenic
1070578844 10:77703404-77703426 CTGTGTGACCACATGGCAGAAGG - Intergenic
1070996114 10:80784470-80784492 CTGTGTTCCCACATGGTAGAAGG - Intergenic
1071179642 10:82968026-82968048 CTGTTTCTCCAGATTTAAGGTGG + Intronic
1071549150 10:86552861-86552883 CTGTGTCTTCACATGGTGGAAGG - Intergenic
1071837360 10:89431791-89431813 CTGAGTCTTCAGATTGAAGAGGG - Exonic
1072070408 10:91909601-91909623 CTGTCTCTCCAGATGGATGATGG + Intergenic
1072100174 10:92221869-92221891 CTGTGTCCTCACATGGCAGAAGG - Intronic
1072273606 10:93801266-93801288 CTGAGTGTCAGGATGGAAGATGG - Intergenic
1072292050 10:93973090-93973112 CTGTGTCTTCACATCGGAGAGGG + Intergenic
1072313613 10:94180816-94180838 CTGTGTCCTCACATGGCAGAAGG - Intronic
1072494669 10:95945033-95945055 CTGTGTCCTCACATGGCAGATGG - Intergenic
1073141084 10:101248235-101248257 CTGTGTCTTCACATGGAGGAAGG + Intergenic
1073532990 10:104249998-104250020 CTGTTTCTTCAGTTGGAAGGTGG - Intronic
1073722458 10:106188576-106188598 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1073914844 10:108390234-108390256 CTGAGGCTCCAGATGCAAGCAGG - Intergenic
1074219737 10:111424773-111424795 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
1074450785 10:113558103-113558125 CTTTGTCTCCTGCTGGAAGCTGG - Intronic
1074610108 10:115013868-115013890 CTCTGTCTGCACATGGCAGAAGG + Intergenic
1075098264 10:119487924-119487946 CTGTGTCCTCACATGGTAGAAGG - Intergenic
1075133981 10:119765997-119766019 CTGGTTCTCCAGATTGCAGATGG - Intronic
1075256865 10:120932281-120932303 CTGTGTGTTCAGATGGGAGCTGG - Intergenic
1075270705 10:121047715-121047737 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
1075350958 10:121724981-121725003 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1075436191 10:122444675-122444697 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1075593290 10:123708173-123708195 GTGTGTCTTCACATGGCAGAAGG - Intronic
1075872393 10:125780251-125780273 CTGTGTCCTCATATGGCAGACGG - Intergenic
1076521668 10:131085111-131085133 CTGTGTCCCCACAGGGCAGAGGG - Intergenic
1076603825 10:131676773-131676795 CTGTTGCTCCAGATGTCAGAAGG + Intergenic
1076649691 10:131979375-131979397 CTGTGTCTGCAACTGGCAGATGG - Intronic
1076666988 10:132098859-132098881 CTGTCTCTCCAGGAGGAAGGAGG - Intergenic
1076822658 10:132947143-132947165 CGGTGTCTGCAGAAGGCAGAGGG - Intergenic
1077399287 11:2345790-2345812 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
1077509730 11:2951799-2951821 GTGTTTCTCCAGTTTGAAGAAGG - Exonic
1077805452 11:5587545-5587567 CTGTGTCTTCACATGGAGAAAGG + Intronic
1077875939 11:6305783-6305805 CTATGTCTTCACATGGTAGAAGG - Intergenic
1078412696 11:11140439-11140461 CTGTGTCCTCACATGGTAGAAGG - Intergenic
1078486817 11:11730945-11730967 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
1078735415 11:14015344-14015366 CTGTGTCCTCAGGTGGTAGAAGG + Intronic
1079203064 11:18391900-18391922 CTGAGTCTCCAGCTTGCAGATGG - Intergenic
1079250875 11:18786663-18786685 CTGTGGCTGCAGATGGAATCTGG + Intronic
1079610745 11:22429944-22429966 CAGTGTCTCCATATGTAAAATGG + Intergenic
1079738495 11:24028221-24028243 CTGTATCTTCACATGGTAGAAGG + Intergenic
1079857416 11:25623468-25623490 CTTTGTCTTCATGTGGAAGAAGG + Intergenic
1080081847 11:28229601-28229623 CTGTGTCCTCACATGGCAGAAGG - Intronic
1080116240 11:28624393-28624415 CTGTGTCGTCTCATGGAAGAAGG + Intergenic
1080559102 11:33445842-33445864 TTGTGTCCCCACATGGCAGAAGG - Intergenic
1080867518 11:36208446-36208468 CTGTGTCCCCAGGTGGCCGAAGG + Intronic
1080877747 11:36292059-36292081 CTGTTTCTCCATATGTAAAATGG - Intergenic
1080970335 11:37266823-37266845 TTGTGTCCCCACATGGTAGAAGG + Intergenic
1080991365 11:37539871-37539893 CTGTGTCTTCACATGGAGGGAGG - Intergenic
1081260826 11:40958053-40958075 CTGTGTCTTCATTTGGTAGAAGG - Intronic
1081445576 11:43128785-43128807 CTGTGTCATCACATGGAGGAAGG - Intergenic
1081539777 11:44024317-44024339 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
1081783619 11:45731006-45731028 CTATGTCTTCACATGGCAGAAGG + Intergenic
1082257264 11:50044626-50044648 CTAAGTCTCCAGATTAAAGAGGG - Intergenic
1082806498 11:57454995-57455017 CTGTTTCTCCATCTGTAAGAAGG + Intergenic
1082990222 11:59201143-59201165 CTGTGTCCCCACATGGTAGAAGG + Intronic
1084081106 11:66825528-66825550 CTGTGTCCTCACATGGCAGAAGG - Intronic
1084469734 11:69352064-69352086 CTGGGTCTCCAGCTTGCAGAGGG - Intronic
1084736858 11:71110977-71110999 CTGTGTCTTCACGTGGAGGAAGG - Intronic
1084788129 11:71455629-71455651 CTGTGTCCTCACATGGTAGAAGG - Intronic
1084851267 11:71942936-71942958 CTGTGTCTTCACATGGCAGAAGG + Intronic
1085294300 11:75422162-75422184 CTGAGTCTTCACATGGGAGAGGG - Intronic
1085299427 11:75449713-75449735 CAGTGTCCCCAGTTGGCAGATGG - Intronic
1085621637 11:78042125-78042147 CTGTGACACCAGAAGCAAGATGG - Intronic
1085765714 11:79279986-79280008 CTGTGTCCTCAAATGGCAGAGGG - Intronic
1086214016 11:84355459-84355481 CTGTGTCTTCACTTGGCAGAAGG - Intronic
1086363309 11:86081623-86081645 CTGTGTCTTCACATGGCAGGAGG - Intergenic
1086843880 11:91723492-91723514 ATGTGTCTCCAGGTGAGAGAGGG + Intergenic
1087087009 11:94230071-94230093 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1087147483 11:94826518-94826540 CTGTGTCACAACATGGCAGAAGG + Intronic
1087632326 11:100664881-100664903 CTTTGTCTTCACATGGCAGAAGG + Intergenic
1087923147 11:103890055-103890077 CTGTGTCCTCACATGGCAGAGGG + Intergenic
1088019139 11:105098105-105098127 CTATGTATACATATGGAAGAAGG + Intronic
1088324193 11:108585453-108585475 CTGTGTCCTCACATGGTAGAAGG - Intronic
1089101857 11:115969178-115969200 GTGTGTCTCCACATGTGAGATGG - Intergenic
1089173549 11:116532748-116532770 CTGTGTCTTCAGATGGTGAAAGG - Intergenic
1089238750 11:117055854-117055876 CTGTGTCCTCACATGGCAGAAGG - Intronic
1089333877 11:117709357-117709379 CTGTGTCCTCACATGGCAGATGG + Intronic
1090213016 11:124936114-124936136 CTGTGTATTCAGAGGGAAGTTGG - Exonic
1090283585 11:125479688-125479710 CTGTGTCCCCACATGGTAGAAGG - Intronic
1090346447 11:126075487-126075509 CTGTGTCTTCACATGGCAGAAGG - Intergenic
1090641637 11:128734335-128734357 CTGAGTACTCAGATGGAAGAAGG + Intronic
1090925599 11:131247363-131247385 CTTTGTCAACAGAAGGAAGAAGG - Intergenic
1091312240 11:134582870-134582892 CTGTGTCTGCTCAGGGAAGAAGG - Intergenic
1091553872 12:1557458-1557480 CTGTGTCCTCACATGGCAGAAGG + Intronic
1091963765 12:4721031-4721053 CTGTGCCTTCAAATGGGAGATGG + Intronic
1092082926 12:5733041-5733063 CTGTTTCTCCAGCTGGGAGTTGG - Intronic
1092643574 12:10543814-10543836 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
1092747946 12:11691108-11691130 CTGTGTCCTCACATGGCAGAAGG + Intronic
1092763352 12:11829382-11829404 CTGTTTCTCCAGCGGTAAGATGG - Intronic
1092813993 12:12297159-12297181 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
1092908302 12:13122512-13122534 CTGTGTCACCACATGGTGGAAGG + Intronic
1093010181 12:14099336-14099358 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
1093269493 12:17041776-17041798 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1093747805 12:22762810-22762832 CTATGTCTTCACATGGTAGAAGG - Intergenic
1094005313 12:25742911-25742933 CTGTGCCCTCACATGGAAGAGGG + Intergenic
1094027422 12:25973746-25973768 CTGTGTCCTCACATGGTAGAAGG - Intronic
1094045661 12:26163536-26163558 CTGTGTCGTCACATGGCAGAAGG + Intronic
1094083109 12:26559460-26559482 CTGTGTCCTCACATGGTAGAAGG + Intronic
1095270634 12:40214620-40214642 TTGTGTCTTCACATGGTAGAAGG - Intronic
1095991840 12:48040148-48040170 CTGTGTCTCCCGATCCAAGCTGG - Intergenic
1096038179 12:48491283-48491305 CTGTGTCCTCACATGGAGGAAGG + Intronic
1096345098 12:50839237-50839259 CTGTTTCTCCAGCTTGCAGATGG + Intergenic
1096874296 12:54615289-54615311 CTCTCTCTCCATCTGGAAGATGG + Intergenic
1097072417 12:56364865-56364887 CTGTGTCTCCAGAAAAAAAAAGG - Intergenic
1097424562 12:59427523-59427545 CTGTGTCCTCACATGGGAGAAGG + Intergenic
1098015802 12:66103423-66103445 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1098158697 12:67626324-67626346 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
1098327063 12:69313846-69313868 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1098345385 12:69497444-69497466 CTGTGTCCTCACATGGTAGAGGG + Intronic
1098529672 12:71527466-71527488 CTGTGTCTTCCTATGGCAGAAGG + Intronic
1098763881 12:74460172-74460194 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
1098954503 12:76675787-76675809 ATGTGTCTTCACATGGTAGAAGG - Intergenic
1099507500 12:83497652-83497674 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1099597181 12:84681908-84681930 CTGGGTCTCCAAATTGTAGATGG + Intergenic
1099744097 12:86679683-86679705 CTGTGTCCTCACATGGTAGAAGG - Intronic
1099858247 12:88197390-88197412 TTGTGACTCCAGATAAAAGATGG + Exonic
1099921601 12:88964511-88964533 CTGTGTGTCCAGGGGCAAGAAGG - Intergenic
1100063934 12:90616846-90616868 CTGTGTCTTCACATGGCAGAAGG - Intergenic
1100223159 12:92528502-92528524 CTGGGTCTCCAGGTTGTAGATGG + Intergenic
1100232548 12:92623021-92623043 CTGTGTCACCCCATGGCAGAAGG - Intergenic
1100339653 12:93666233-93666255 CTGTGTCTTTACATGGTAGAGGG - Intergenic
1100506387 12:95224827-95224849 CAGTTTTTCCAGATGGAGGATGG + Intronic
1100593684 12:96053406-96053428 CTGTGTCTTCACATGGTGGAAGG - Intergenic
1100752190 12:97710583-97710605 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1100806308 12:98287505-98287527 CTGTGTCCCCACATGGCAGAAGG - Intergenic
1101375754 12:104169976-104169998 CTGTTTCTCCAGCTTGCAGATGG - Intergenic
1101423432 12:104567867-104567889 CTGTGTCTTCACATGGCAGAGGG - Intronic
1101518018 12:105454983-105455005 CTGTGTCCTCACGTGGAAGAAGG - Intergenic
1101860917 12:108481774-108481796 CTGTGTCCTCACATGGAGGAAGG - Intergenic
1101894946 12:108749351-108749373 CTGAGTCTCCAGTTTGCAGATGG - Intergenic
1101919917 12:108924105-108924127 CTGTGTCCTCAGATGGCATAAGG - Intronic
1102005324 12:109586010-109586032 CTGTGTCTTCAGGTGGACCAAGG + Exonic
1102189411 12:110975391-110975413 CAGTGTCTCCACCTGGAAAATGG + Intergenic
1102350116 12:112185616-112185638 CTGTTTCTCCATCTGTAAGAAGG - Intronic
1102442398 12:112973705-112973727 CTGAGTCTCCAGCTTGCAGACGG - Intergenic
1102450630 12:113039380-113039402 CTGTGTCTTCATATGGCTGAAGG + Intergenic
1102879496 12:116473519-116473541 CTGTATCCTCACATGGAAGAAGG - Intergenic
1103311300 12:120011119-120011141 CCGAGTCACAAGATGGAAGATGG - Intronic
1103581897 12:121921622-121921644 CTGTGTCTCCAAACGGATCATGG - Exonic
1105401211 13:20097654-20097676 CAGTGTCTCCATATGTAAAACGG - Intergenic
1105519317 13:21117366-21117388 CTGTGTCCTCATATGGCAGAGGG + Intergenic
1105700373 13:22931413-22931435 CTGGGTCTCTAGCTGGCAGATGG - Intergenic
1105853139 13:24353456-24353478 CTGGGTCTCCAGCTGGCAGATGG - Intergenic
1105930362 13:25046936-25046958 CAGCGTCTCCAGATAAAAGAAGG - Intergenic
1106076698 13:26466540-26466562 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
1106101831 13:26700324-26700346 CTGAGTCTCCAGCTTGCAGATGG - Intergenic
1106199796 13:27526850-27526872 CTGTGTCACAACATGGCAGAAGG - Intergenic
1106546342 13:30734010-30734032 CTGAGTCTCCAGCTTGCAGATGG + Intronic
1106999352 13:35525834-35525856 CTGTGTCTTCACATGGTGGAAGG + Intronic
1107414041 13:40184621-40184643 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1107634102 13:42374598-42374620 CTGTGTCCTCACATGGAGGAAGG + Intergenic
1107670215 13:42737952-42737974 CTGTGTCCCCATATGGTAGAAGG + Intergenic
1107747553 13:43526935-43526957 CTGTGTCTTCACACGGCAGAAGG - Intronic
1107876084 13:44791576-44791598 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1108679508 13:52767387-52767409 CTGTGTCTTCACATGGAAGAAGG - Intergenic
1108754895 13:53487708-53487730 CTGGTTCTCCAGATTGCAGATGG + Intergenic
1109153282 13:58871637-58871659 CTGGGTCTCCAGTTTGCAGATGG + Intergenic
1109330005 13:60917910-60917932 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1109330229 13:60919912-60919934 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1109384088 13:61604631-61604653 CTGTGTTCCCACATGGCAGAAGG - Intergenic
1109720148 13:66265553-66265575 CAGTGACTCCTGATGGAAGAAGG + Intergenic
1109732656 13:66436303-66436325 CTGTGTCTTCACAAGGCAGAAGG - Intronic
1109965414 13:69686748-69686770 CTGGCTCTCCAGATTGAAGATGG - Intergenic
1110187286 13:72690359-72690381 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
1110241266 13:73269898-73269920 CTGTGTCTTCACATGGCAGAAGG - Intergenic
1110285055 13:73740243-73740265 CTGTGTCTTCACATGGTAGAAGG - Intronic
1110727290 13:78840033-78840055 CTGTGTCCACACATGGTAGAAGG + Intergenic
1110827792 13:79993011-79993033 CTGTGTCTTCACATGTTAGATGG + Intergenic
1110854777 13:80284026-80284048 CTGTCTCTCCACATGGCAGAAGG - Intergenic
1111072765 13:83189621-83189643 TTGTGTTGCCAGATAGAAGAAGG + Intergenic
1111258716 13:85706787-85706809 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1111529212 13:89515108-89515130 CTGGTTCTCCAGCTGGCAGAAGG - Intergenic
1111819596 13:93196280-93196302 CTGTGTTTTGAGATGGATGAAGG - Intergenic
1112025202 13:95405364-95405386 CTGTGTCTTCTGGTGGAGGAGGG + Intergenic
1112103726 13:96218177-96218199 CTGTGTCCCCAGAGAGAAGTGGG + Intronic
1112191356 13:97181024-97181046 CTGGCTTTCAAGATGGAAGAAGG - Intergenic
1112195266 13:97219561-97219583 CTGTGTCTTCACATGGTAAAGGG + Intergenic
1112263731 13:97902937-97902959 CTGTGTCCTCATATGGCAGAAGG - Intergenic
1112283442 13:98082834-98082856 CTGTGTCCTCATATGGTAGAAGG - Intergenic
1112602350 13:100868966-100868988 GTGTGTCTCCAGTTCCAAGATGG + Intergenic
1112640259 13:101265710-101265732 CTGTTTCTCCATATGTAAAAGGG - Intronic
1112906575 13:104429747-104429769 CTGTGTCCTAAGATGGCAGAAGG + Intergenic
1112912657 13:104507514-104507536 CTGGGTCTCCAAAAGGAGGAAGG - Intergenic
1113302628 13:109038533-109038555 CTGGGTCTCCAGCTTGCAGATGG + Intronic
1113492576 13:110704003-110704025 CTGTGTCCTCACATGGTAGAAGG - Intronic
1113507338 13:110826309-110826331 ATGAGTCTCCTGATGGTAGATGG + Intergenic
1113522281 13:110949461-110949483 ATGTGTCCCCATATGTAAGAGGG + Intergenic
1113581218 13:111430882-111430904 GTGTCTCCCCAGATGGAACAAGG + Intergenic
1113818470 13:113192936-113192958 CTGTGTCTGCACATGGTAGATGG - Intronic
1113971362 13:114193475-114193497 CTGTGTCCTCATATGGCAGATGG + Intergenic
1114195895 14:20475836-20475858 CTGTACCTCTAGCTGGAAGATGG + Intronic
1114260001 14:21029756-21029778 CTGTGTCCTCACATGGTAGAAGG - Intronic
1114584535 14:23798279-23798301 CTGTCTCCTCACATGGAAGAAGG - Intergenic
1114838357 14:26232027-26232049 CTGTGTCCTCACATGGTAGATGG - Intergenic
1114838564 14:26234227-26234249 CTGAGTCTTCACATGGCAGAAGG + Intergenic
1115373875 14:32651614-32651636 CTGTGTCCTCACATGGCAGAAGG + Intronic
1115909421 14:38239173-38239195 CTGAGTCAACACATGGAAGATGG + Intergenic
1116861292 14:49997669-49997691 CTGGGTCTCCAGCTTGTAGATGG + Intronic
1117202518 14:53406777-53406799 CTGTGTCCTCAGATGGCAGAAGG - Intergenic
1117733080 14:58743481-58743503 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1117906035 14:60588441-60588463 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
1118427310 14:65680137-65680159 CTGGGTCTCCAGCTTGCAGATGG - Intronic
1118437854 14:65787765-65787787 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1118732269 14:68676847-68676869 CTGTGTCTCCACATGCAGGCAGG + Intronic
1118787703 14:69059820-69059842 ATGTGCCTCCTGGTGGAAGAGGG + Intronic
1119167305 14:72505369-72505391 CTGTGTCTTCACATGACAGAAGG + Intronic
1119537262 14:75412628-75412650 CTGTGTCCTCACATGGTAGAAGG - Intergenic
1119640290 14:76309774-76309796 GTGGGTCTCCAGATGGCAGATGG + Intergenic
1120150075 14:81022946-81022968 CTGTGTCCTTAGATGGCAGAAGG - Intronic
1120269736 14:82296209-82296231 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
1120413156 14:84184060-84184082 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1120498908 14:85269687-85269709 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1120566719 14:86068755-86068777 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1120592076 14:86388294-86388316 CTGTGTCTTCACATGACAGAAGG + Intergenic
1120865523 14:89292602-89292624 CTGTGTCTTCACATGGCAGAAGG - Intronic
1120924567 14:89784762-89784784 CTGTGTCCTCACATGGTAGAAGG - Intergenic
1120964968 14:90158905-90158927 GTGGGTCCCCAGTTGGAAGAGGG + Intronic
1121486182 14:94316990-94317012 CTGGGTCTCCAGCTTGCAGATGG + Intronic
1121626764 14:95390876-95390898 CTGTGGCACCACATGGCAGAAGG - Intergenic
1121663939 14:95657793-95657815 CTGAGTCTCCAGCTTAAAGACGG + Intergenic
1121681839 14:95799935-95799957 CTGTGTCTTCACATGGTAGAAGG - Intergenic
1121710442 14:96034758-96034780 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
1121853171 14:97242374-97242396 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1121873391 14:97429815-97429837 CTATGTCCTCAGATGGCAGAAGG + Intergenic
1122038901 14:98968223-98968245 CTGTATCTTCACATGGCAGAAGG - Intergenic
1122239616 14:100353924-100353946 CTGTGTTTTCAGATGCACGATGG - Intronic
1122304697 14:100755511-100755533 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1122361695 14:101171072-101171094 CTGTGTCTTCACATGGCAGAAGG + Intergenic
1122671528 14:103376389-103376411 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1122810674 14:104286267-104286289 CTGTGTCCTCACATGGAGGACGG + Intergenic
1123166131 14:106326769-106326791 CTGTTACTCCTGAGGGAAGATGG - Intergenic
1123168826 14:106351804-106351826 CTGTTACTCCTGAGGGAAGATGG - Intergenic
1123404987 15:20014083-20014105 CTGTGTCATCATATGGCAGAAGG - Intergenic
1123514318 15:21020731-21020753 CTGTGTCATCATATGGCAGAAGG - Intergenic
1124013633 15:25859262-25859284 CTGAGTGTCCAGCTGGAACAGGG - Intronic
1124026855 15:25974786-25974808 CTGAGTCTCCAGTTTGCAGATGG + Intergenic
1124356566 15:28999838-28999860 CTGGGTCTCCAGCTTGCAGATGG - Intronic
1125347593 15:38733715-38733737 CTGTGTCTTCATGTGGTAGATGG + Intergenic
1125852564 15:42918987-42919009 CTGTGTCTAAAACTGGAAGAGGG + Intronic
1125925389 15:43558883-43558905 CAGTGTTTCCAGAGGGTAGATGG + Exonic
1125962699 15:43845435-43845457 CTGTGTCCTCATATGGTAGAAGG - Intronic
1126200343 15:45978678-45978700 CTGTGTCCTCACATGGAAGAAGG + Intergenic
1126565300 15:50090509-50090531 CTGTGTCCTCACATGGCAGAAGG - Intronic
1126964029 15:54030786-54030808 CTGTGTCCTCAGGTGGCAGAAGG + Intronic
1127241597 15:57121594-57121616 CTGTATCTTCAAATGGCAGAAGG - Intronic
1127362682 15:58258945-58258967 CTGTGTCTTCACATGGCGGAAGG + Intronic
1127795233 15:62432384-62432406 CTGTGTCCTCACATGGTAGAAGG + Intronic
1128194200 15:65736129-65736151 ATGTGTCTACATTTGGAAGATGG + Intronic
1128401919 15:67292102-67292124 CTGTGTCTGCACATGGAAGAGGG - Intronic
1128443034 15:67731259-67731281 CTGTGTCACCAGCAGGAAGAGGG - Intronic
1129147243 15:73659779-73659801 CTGTGTGTGCAGAAGGAAAAAGG + Intergenic
1129504332 15:76068643-76068665 CTGTGTCCTCACATGGAAGCAGG - Intronic
1129580471 15:76803667-76803689 CTGTGTCTTCACATGGTGGAGGG + Intronic
1129630013 15:77248566-77248588 CTGTGTCCTCACATGGCAGAAGG - Intronic
1129794294 15:78364261-78364283 CTGTAACTCCATATAGAAGATGG - Intergenic
1129911380 15:79229942-79229964 CTGTGTCCTCATATGGCAGAAGG - Intergenic
1130081998 15:80742212-80742234 CTGGGTCTCCAGCTTGCAGATGG - Intronic
1130274466 15:82469262-82469284 CTGTGTCCCCAGATGTGGGAGGG + Intergenic
1130405984 15:83602453-83602475 CTGTGTCCTCACATGGCAGAAGG + Intronic
1130414324 15:83676815-83676837 CTGTGTTTTCACGTGGAAGAAGG - Intronic
1130429607 15:83833349-83833371 CTGTGTCCTCACATGGCAGAAGG + Intronic
1130589108 15:85201229-85201251 CTGTGTCCCCAGATGTGGGAGGG + Intergenic
1130799145 15:87243454-87243476 CTGAGTCTCCACATGGATAAGGG - Intergenic
1131533202 15:93212263-93212285 CTGTGTCTTCACATGGTAGAAGG - Intergenic
1131539952 15:93267656-93267678 CTGTGTCCTCACATGGTAGAGGG + Intergenic
1131560745 15:93437250-93437272 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1132001273 15:98182276-98182298 CTGTGTCTTCAGATAGTGGAAGG - Intergenic
1132253112 15:100349631-100349653 CTCTGTCTATAGGTGGAAGAAGG + Intergenic
1132777539 16:1603949-1603971 CTGTGTTTCCAGTTGGCACAAGG - Intronic
1132968828 16:2674908-2674930 CTGTGTCTCCAGAGGGCAGAGGG - Intergenic
1132979016 16:2725442-2725464 CTGGCTCTGCAGATGGAGGAAGG - Intergenic
1133625168 16:7564221-7564243 CTGTGTTCTCAGATGGAAGAGGG - Intronic
1133821228 16:9238313-9238335 CTGTGTCTCCAGCTTTAAGTTGG + Intergenic
1134879094 16:17728617-17728639 CTGTGTATACACATGAAAGAGGG + Intergenic
1135253654 16:20922853-20922875 CTGGGTCTCCAGCTTGCAGACGG - Intronic
1135290947 16:21237559-21237581 CTGTGTCCTCACATGGAGGAAGG + Intronic
1135664575 16:24325150-24325172 CTGTGTCTACTGGGGGAAGAGGG + Intronic
1135790844 16:25393919-25393941 CTGAGTCTCCAGCTTGCAGATGG - Intergenic
1136007155 16:27338721-27338743 CTGTGTCTTCATATGACAGAAGG - Intronic
1136079306 16:27841154-27841176 CTGTGTCCTCAGCTGGAAAATGG - Intronic
1136186293 16:28590759-28590781 GTGTGTCTCCTGGGGGAAGAGGG - Exonic
1136188667 16:28602472-28602494 GTGTGTCTCCTGGTGGTAGAGGG - Intergenic
1136191137 16:28615466-28615488 GTGTGTCTCCTGGTGGTAGAGGG - Intronic
1136579210 16:31141844-31141866 ATGAGTCTGCAGAGGGAAGAAGG + Exonic
1137002625 16:35243101-35243123 CTGTGTCTGCACATGGCAGAAGG - Intergenic
1137462645 16:48679502-48679524 CTGTGCCTTCACATGGCAGAAGG - Intergenic
1137543062 16:49377884-49377906 CTGGGTCTCCAAATGGAGGAGGG + Intronic
1137727085 16:50664206-50664228 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
1137982070 16:53078416-53078438 CTGTGTCATCAGGTGGCAGAAGG - Intronic
1138120114 16:54393932-54393954 TTGTGTCTTCATATGGCAGAAGG - Intergenic
1138719381 16:59061149-59061171 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
1138954382 16:61953093-61953115 CTGTGTCCCCACATGGTGGAAGG - Intronic
1139011111 16:62635532-62635554 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1139022812 16:62772857-62772879 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1139024895 16:62804519-62804541 TTGTGTCTTCACATGGCAGAAGG - Intergenic
1139063259 16:63281660-63281682 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
1140020482 16:71233671-71233693 CTGTGTCTTCACATGGCAGAAGG - Intergenic
1140231094 16:73117833-73117855 CTGTGTCCTCATATGGTAGAAGG - Intergenic
1140706875 16:77638972-77638994 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1140777650 16:78264756-78264778 CTGTGTCCTCACATGGCAGAAGG - Intronic
1140916623 16:79499627-79499649 CTGTGTCTTCATATGGGGGAAGG - Intergenic
1141310758 16:82911536-82911558 CTGTGTCTCCATCTGTAAAATGG + Intronic
1141547998 16:84785248-84785270 CTGTGTCTTCTGATGGAAACAGG - Intergenic
1141664569 16:85459235-85459257 CTGTGTCTCCACATGCATGCAGG + Intergenic
1142023939 16:87802218-87802240 CAGTGTGTGCAGATGGCAGATGG - Intergenic
1142422164 16:89978284-89978306 CTGTGTCTCCACAGAGTAGAAGG + Intergenic
1203143147 16_KI270728v1_random:1782105-1782127 GTGGATCCCCAGATGGAAGATGG + Intergenic
1142814222 17:2412691-2412713 CTGTGTCTCCTGCTGGGAAAAGG - Intronic
1144384987 17:14741140-14741162 CTCTGTCTTCACATGGCAGAAGG + Intergenic
1144457014 17:15427009-15427031 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1144491834 17:15719547-15719569 CTGTGTCTTCACATGGTAGAAGG + Exonic
1144908646 17:18659657-18659679 CTGTGTCTTCACATGGTAGAAGG - Exonic
1144938155 17:18916812-18916834 CTGTGTCCTCAGATGGTGGAAGG + Intronic
1145378411 17:22373054-22373076 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1145956868 17:28860717-28860739 CTGTGTCTTCTGTTGGAAGAAGG + Exonic
1146080190 17:29772944-29772966 CGGTGTCTCCAGCTTGCAGATGG + Intronic
1146417072 17:32644800-32644822 GTGTGTCTCTACATGTAAGATGG + Intronic
1148155687 17:45424252-45424274 CTCTGTTTCCAGATTGCAGAAGG - Intronic
1148729699 17:49825915-49825937 CTGTGTGCCAACATGGAAGAAGG - Intronic
1148919622 17:51019103-51019125 CTGTGTCTTCACATAGAAGAAGG - Intronic
1148971937 17:51491261-51491283 CTGTGTCCTCACATGGAAGAAGG - Intergenic
1148994694 17:51699443-51699465 GTGTGTCTCCGGTTGCAAGAAGG - Intronic
1149258632 17:54855477-54855499 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1149344116 17:55717036-55717058 CTGTGCCCTCAGATGGTAGAAGG - Intergenic
1149436041 17:56634216-56634238 CTGTGTCTACACATGGTGGAAGG + Intergenic
1149795237 17:59513230-59513252 GTGTGTCTCAAGATGGGATAAGG + Intergenic
1150387370 17:64772908-64772930 CTCTGTTTCCAGATTGCAGAAGG - Intergenic
1150524006 17:65902545-65902567 TTGTGTCAACAGATTGAAGAAGG - Intronic
1150600663 17:66648113-66648135 CTGTGTCCTCACATGGCAGAAGG + Intronic
1150981115 17:70142602-70142624 CTGTGTTTCCACAGGGTAGAAGG - Intergenic
1151512881 17:74572200-74572222 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1151532797 17:74717867-74717889 CTGTGTCCTCACATGGTAGAAGG - Intronic
1151716552 17:75834133-75834155 TTGTGTCTCCAGTTGGAGGTGGG - Exonic
1151950016 17:77346892-77346914 CTGTGTCCCCACATGGCAGAAGG - Intronic
1152346377 17:79754855-79754877 CTGTGTCCTCACATGGAGGAAGG + Intergenic
1153122335 18:1743914-1743936 CTGTGTCTCTACATGGCAGAAGG - Intergenic
1153339230 18:3957225-3957247 CTGAGTTTGGAGATGGAAGAAGG + Intronic
1153967890 18:10198140-10198162 CTGTGTCTTCATGTGGTAGAAGG + Intergenic
1154179467 18:12119525-12119547 CTGTGTCCTCACATGGCAGAAGG + Intronic
1154491878 18:14928648-14928670 CTGAGTCTCCAGATTGCAGATGG + Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1155798187 18:30066332-30066354 CTGTTTCTTCACATGGAGGAAGG + Intergenic
1156423324 18:36980031-36980053 CTGTGTCATCACATGGCAGAAGG - Intronic
1156685297 18:39637693-39637715 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1156786733 18:40924005-40924027 CTATGTCTTTAGATGGCAGAGGG - Intergenic
1156931444 18:42649641-42649663 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1157301752 18:46484438-46484460 CTGTGTCCTCACATGGCAGAAGG - Intronic
1157423323 18:47563982-47564004 TTGTGTCTTCACATGGCAGAAGG - Intergenic
1157436885 18:47677890-47677912 CTGTGTCCTCACATGGTAGAAGG + Intergenic
1157444421 18:47734029-47734051 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
1157449118 18:47772372-47772394 CTGCCTCTCCCGATGGAAGTAGG + Intergenic
1157647035 18:49285022-49285044 CTGTGTCTTCACATGGCAGAAGG - Intronic
1157690658 18:49679318-49679340 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
1157772193 18:50358932-50358954 GTGTGTGTCCTGATGGCAGAGGG + Intergenic
1157942666 18:51946133-51946155 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1157992211 18:52510602-52510624 CTATGGCTCAAGAAGGAAGATGG - Intronic
1158135843 18:54207247-54207269 ATGTCTTTCCAGATGGAAGGAGG + Intronic
1158149787 18:54355530-54355552 CAGTGTCCTCACATGGAAGAAGG - Intronic
1158727566 18:59987384-59987406 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1158788205 18:60740989-60741011 CTGTGTCCCCACATGGCAGAGGG + Intergenic
1158876708 18:61741029-61741051 CTGTGTCTTCACATGGTAGAAGG + Intergenic
1159202962 18:65211394-65211416 CTGTGTCTTCACACGGCAGAAGG - Intergenic
1159536961 18:69726787-69726809 CTGTGTCCTCACATGGTAGATGG + Intronic
1159651997 18:70988544-70988566 TTCTGTCTTCACATGGAAGAAGG + Intergenic
1160041247 18:75347693-75347715 CTGTTTCTCCTCATGGCAGAAGG + Intergenic
1160053804 18:75461115-75461137 CTGTGTCTTCACATGGCAAAAGG + Intergenic
1160132655 18:76242151-76242173 CTGTGTCCTCACATGGTAGAAGG - Intergenic
1160752851 19:742794-742816 AACTGTCTACAGATGGAAGAAGG - Intronic
1160944097 19:1633192-1633214 CTGTGGCCCCCGATGGAAGGGGG - Intronic
1162994347 19:14324538-14324560 CTGAGTCTCCAGCTTGCAGATGG - Intergenic
1163049693 19:14673037-14673059 CTCTGTCTCCAGTTGCAAAAAGG + Intronic
1163431191 19:17268779-17268801 CTGTGTGGCTAGATGGAACACGG - Exonic
1163621549 19:18363796-18363818 CTGTGTCCCCAGATGCAGGGAGG - Exonic
1164760838 19:30727181-30727203 CTGTGTCTTCAAATGTCAGAAGG + Intergenic
1164880559 19:31729187-31729209 CTGGGTCTCCAGCTTGCAGAGGG + Intergenic
1165338974 19:35196952-35196974 CTGTGTCTTCACATGGTAGAAGG + Intergenic
1165579212 19:36847870-36847892 CTGTGTCCCCACATGTCAGAAGG - Intronic
1165600086 19:37047349-37047371 CTGTGTCCTCACATGGCAGAAGG - Intronic
1167162380 19:47776777-47776799 CTGTTTCTCCATTTGGAAGTTGG - Intergenic
1167841438 19:52124888-52124910 CTGTGTCCCCACGTGGCAGAAGG + Intronic
1167845339 19:52158999-52159021 CTGTGTCCTCACATGGCAGAAGG - Intronic
1167958888 19:53090281-53090303 CTGGGTCTCCAGAGAGATGAAGG - Intronic
1168208535 19:54871106-54871128 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
1168281734 19:55309564-55309586 CTGTGTCTTCACATGGCAGAAGG + Intronic
1168449859 19:56457937-56457959 CTGTGTCTGCACATGGAGGAAGG - Intronic
1202707046 1_KI270713v1_random:31730-31752 CTGTGGCTTCTGACGGAAGAAGG - Intergenic
925098164 2:1224057-1224079 CTGTGTCTCCCTGTGGAGGAAGG + Intronic
925177002 2:1793132-1793154 CTGTGTCTTCAGATGGCACCAGG + Intronic
925310050 2:2875693-2875715 CTGTGTCTTAACATGGAATAAGG + Intergenic
925429479 2:3778668-3778690 CAGTTTCTCCAGATGCAGGATGG - Intronic
925438394 2:3862502-3862524 CTGGTTCTCCAGCTGGCAGAAGG - Intergenic
925880638 2:8349604-8349626 CTGTGTCCTCACATGGCAGAAGG + Intergenic
926056985 2:9779411-9779433 CAGAGTCTCCGGAAGGAAGATGG + Intergenic
926089293 2:10040008-10040030 CTGTCTGTCCATCTGGAAGATGG + Intergenic
926272260 2:11375674-11375696 TTGTGTCTCCAGATAGCAGCTGG - Intergenic
926348099 2:11967983-11968005 CTGTGTCACCAGGTATAAGAAGG + Intergenic
926379872 2:12276203-12276225 CTGTGTCTTTACATGGCAGAAGG - Intergenic
926489492 2:13506439-13506461 CTGTGTCATCACATGGCAGAAGG + Intergenic
926842120 2:17092505-17092527 CTGGGTCTCCAGCTGGCAAAGGG + Intergenic
926843792 2:17111041-17111063 CTGTGCCTTCACATGGTAGAAGG + Intergenic
927039695 2:19215983-19216005 CTGTGACCACAAATGGAAGAAGG - Intergenic
927431855 2:23033261-23033283 CTATGTCTTCACATGGCAGAAGG + Intergenic
927447199 2:23173775-23173797 GTGTGTCTCTACATGTAAGATGG - Intergenic
927715913 2:25352734-25352756 CTGCTTCTCCAGAGGGAAGAGGG + Intergenic
928237124 2:29553264-29553286 TTGTGTCTTCAGATGTCAGAAGG - Intronic
928307158 2:30179639-30179661 CTGTGTCCTCACATGGCAGAAGG + Intergenic
928310368 2:30204737-30204759 CTCAGTCCCCAGATGGAAGAAGG + Intergenic
928376825 2:30781705-30781727 CTGGGTCTCCAGATTGCAGGTGG + Intronic
928411755 2:31059757-31059779 CTGTGTCTTCACATGGCAGAAGG - Intronic
928717840 2:34083295-34083317 CTGCGTCTTCACATGGGAGAAGG + Intergenic
928801201 2:35094964-35094986 CTTTGTCTTCACATGGCAGAAGG + Intergenic
928883290 2:36121753-36121775 CTGTCTTTGCAGATGGAAAAGGG - Intergenic
929314959 2:40465935-40465957 CTGTGTCCTCACATGGCAGAAGG - Intronic
929797852 2:45073735-45073757 CTGTGTCCTCACATGGCAGAGGG - Intergenic
929875340 2:45792143-45792165 CTGTGTCACAACATGGCAGAAGG + Intronic
929920920 2:46171072-46171094 CTGTGTCTCCAGCTGGAAGTGGG - Intronic
929941796 2:46339827-46339849 CTGTGTCTCCACATGGTGGAAGG + Intronic
930324443 2:49897696-49897718 CTGGGTCTCCAGATTGCAGAGGG - Intergenic
930394024 2:50796985-50797007 CTGTGTCCTCACATGGCAGAAGG + Intronic
930505714 2:52280990-52281012 CTGTGTTCTCAGATGGAGGAAGG + Intergenic
930653672 2:53987233-53987255 CTGTTTCTCCATCTGGGAGATGG + Intronic
931210202 2:60186487-60186509 CTGTGTCCTCACATGGCAGAAGG + Intergenic
931332712 2:61304586-61304608 CTGTGTCTTCATTTGGTAGAAGG - Intronic
931831453 2:66055920-66055942 CTGTGTTCTCACATGGAAGAAGG - Intergenic
931914027 2:66933462-66933484 CTGTGGCAGCTGATGGAAGAGGG - Intergenic
931995738 2:67837646-67837668 CTGTGCCTTCACATGGTAGAAGG + Intergenic
932136658 2:69237012-69237034 CTGTGTAATCAGATGGAAAAAGG + Intronic
933107911 2:78356713-78356735 CTGTGTCCTCACATGGCAGAAGG + Intergenic
933316719 2:80724330-80724352 CTCTGTGTCCAGAAGGAAAAGGG - Intergenic
933558172 2:83857766-83857788 CTGTGTCCCCACATGGCAAAAGG - Intergenic
933895783 2:86808648-86808670 CTGGGCCCCCAGATGGAAGACGG - Intergenic
934038555 2:88108866-88108888 GTGTGTCACCTGATGAAAGAGGG + Intronic
934051117 2:88211845-88211867 CTGTCTCTCCAGATGCAATTGGG - Intergenic
934519425 2:95010576-95010598 CACAGTCTCCAGATGGTAGAGGG + Intergenic
935048050 2:99499317-99499339 CTGGTCCTCCAGATGGAAGCTGG - Intergenic
935061805 2:99615214-99615236 CTGGGAGTCCAGATGGTAGAGGG + Intronic
935180621 2:100687371-100687393 CTGTGTCCTCACATGGAGGAAGG - Intergenic
935190232 2:100771694-100771716 CTGGGTCTCCAGCTGGCAGACGG + Intergenic
935328051 2:101955795-101955817 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
935429520 2:102960159-102960181 CTATGTCTTCACATGGCAGAAGG + Intergenic
935478678 2:103557951-103557973 CTGTGTCCTCACATGGCAGAAGG + Intergenic
935622012 2:105138375-105138397 CTGGGCCTCCAGCTCGAAGATGG - Intergenic
935708585 2:105877555-105877577 CTGTGTCTCCAGATGGAAGAGGG - Intronic
935716455 2:105943509-105943531 CTGTGTCCTCACATGGCAGAAGG + Intergenic
936311444 2:111388383-111388405 CTGTGTCCTCACATGGTAGAGGG - Intergenic
936450949 2:112633704-112633726 CTGTGTCCTCAGATGAAGGAAGG - Intergenic
936596902 2:113856785-113856807 CTGTGTCCTCACATGGCAGAAGG - Intergenic
936643957 2:114347883-114347905 CTGTGTCTTCCCATGGCAGAAGG + Intergenic
936986085 2:118312205-118312227 CTGTGTCTTCACATGACAGATGG - Intergenic
936990860 2:118364583-118364605 CTCTGTCTCTCAATGGAAGAAGG - Intergenic
937024389 2:118685838-118685860 CTGTGTCTCCTGATGGATGATGG - Intergenic
937420281 2:121748374-121748396 CTGTGTCTTCATATGGCAGAAGG - Intronic
937494180 2:122400505-122400527 CTGTGTCTTCACATGGCGGAAGG - Intergenic
937782881 2:125859482-125859504 CTGTGTCCTCACATGGTAGAAGG + Intergenic
938586412 2:132695021-132695043 CTATGTCTTCACATGGTAGAAGG + Intronic
938675823 2:133632952-133632974 CGGTGTGTCCAGATGCAAGCTGG - Intergenic
938945874 2:136211632-136211654 CTGTGCCTTCACATGGTAGAAGG + Intergenic
938974723 2:136465276-136465298 CTGTGTCCTCACATGGCAGAAGG + Intergenic
939826094 2:147017222-147017244 CTGTGTCCCCACATGGTGGAAGG + Intergenic
939988457 2:148855183-148855205 CTGTGTCCCCACATGGCAGAAGG - Intergenic
940121086 2:150266850-150266872 CTATGTCCTCAGATGGCAGAAGG + Intergenic
940285564 2:152029787-152029809 CTGTGTCCTCAAATGGTAGAAGG - Intronic
940372571 2:152919115-152919137 CTGTGTCCTCACATGGCAGAAGG - Intergenic
941873746 2:170412448-170412470 CTGAGTCTTCAGACAGAAGAAGG - Intronic
941997757 2:171616791-171616813 CTCTGCCTCCAGCTAGAAGAAGG - Intergenic
942287368 2:174433683-174433705 CTGTGTCCCCACATGGTAGATGG - Exonic
942814945 2:180042032-180042054 CTGGGTCCTCACATGGAAGAAGG - Intergenic
943070604 2:183136535-183136557 CTATATCTGAAGATGGAAGATGG - Intronic
943261219 2:185665964-185665986 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
943618806 2:190124123-190124145 CAGGGTCTCCAGATTGCAGATGG + Intronic
943678872 2:190746485-190746507 CTGTGTCTTCACATGGCAGAAGG - Intergenic
943680035 2:190758729-190758751 CTTTGACTCCTGGTGGAAGAAGG - Intergenic
943790621 2:191928312-191928334 CTGTGGCTACAGAAGGAAGTTGG - Intergenic
943818899 2:192293158-192293180 CTGTGTCCTCACATGGTAGAAGG + Intergenic
943819380 2:192300638-192300660 CTGTGTCTTCACATGGTTGAAGG - Intergenic
943868424 2:192959298-192959320 CTGTATCGTCACATGGAAGAAGG - Intergenic
943976605 2:194486726-194486748 CTGTGTCTTTATATGGAAGATGG - Intergenic
944116414 2:196191785-196191807 CTGTGTTTTCACATGGCAGAAGG + Intergenic
944384336 2:199147884-199147906 CTGTGTCCTCACATGGTAGAAGG - Intergenic
944467605 2:200018786-200018808 CTGTGTCCTCACATGGCAGAAGG + Intergenic
944473720 2:200083015-200083037 ATATGTCTCCAAATGGAAGAAGG + Intergenic
945145463 2:206733470-206733492 CTGTGTCTCCACATGGTGGAAGG - Intergenic
945195486 2:207233526-207233548 CTGTGTCTTCACATGGCAAAAGG - Intergenic
945485076 2:210385724-210385746 CTGAGCCTCCAGATGGATGCAGG - Intergenic
945930721 2:215852544-215852566 CTGTGTCCTCACATGGCAGAAGG + Intergenic
946447916 2:219755360-219755382 CTGTGTCCTCATATGGTAGAAGG - Intergenic
946565693 2:220962184-220962206 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
946637703 2:221747863-221747885 CTGTGTCCTCACATGGCAGAAGG - Intergenic
946661007 2:221999409-221999431 CTGCCTCTGCAGATGGAATATGG + Intergenic
946667314 2:222064590-222064612 CTTTGTCTGCATATGGCAGAAGG - Intergenic
946803422 2:223445257-223445279 CTCTGACTACAGATGGAAAATGG + Intergenic
947028509 2:225765560-225765582 CTATGTCTTCACATGGAAGAAGG - Intergenic
947047433 2:226004498-226004520 CTGTGTCCTCATATGGTAGAAGG + Intergenic
947231279 2:227889363-227889385 CTGCGTCTTCACATGGCAGAGGG + Intronic
947824128 2:233092785-233092807 GCCTGTCTCAAGATGGAAGAAGG - Intronic
947906126 2:233764702-233764724 CTGTGTCTCCCCAAGAAAGAGGG + Intronic
947916420 2:233834915-233834937 CTGTGTCTCGAGATAGCACAAGG - Intronic
948281544 2:236751088-236751110 CTGTGTCTTCAAATGGTAGAAGG + Intergenic
948378063 2:237535173-237535195 CTGTGTCACCACATGGCACATGG + Intronic
948511332 2:238467184-238467206 CTGTGTCCTCACATGGCAGAGGG + Intergenic
948654845 2:239470221-239470243 CTGTGTACCCATATGGCAGAAGG - Intergenic
1168842254 20:916962-916984 CTGTGTCTCCAGAGGCAAAGTGG - Intergenic
1168865363 20:1081372-1081394 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1169133421 20:3180425-3180447 CTGGCTTTGCAGATGGAAGAAGG + Intergenic
1169308918 20:4518817-4518839 CTGTGACCCCAGATGCAAAAAGG - Intergenic
1169331398 20:4719302-4719324 CTGTGTGCCCACATGGCAGAAGG + Intergenic
1169339268 20:4783787-4783809 CTGTGTTTAGAGAGGGAAGAGGG - Exonic
1169358027 20:4924288-4924310 CTCTGACTCCAGAGGGAGGACGG - Intronic
1169737294 20:8850682-8850704 CTGTGTCCTCACATGGCAGAAGG - Intronic
1169801866 20:9518795-9518817 CTGTGCATCCAGAAGGCAGAGGG + Intronic
1169830832 20:9823140-9823162 CTGTGTCCTCACATGGCAGAAGG - Intronic
1169877159 20:10310732-10310754 CTGTGTCCTCACATGGAGGAAGG + Intergenic
1169944645 20:10975625-10975647 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1170382918 20:15781571-15781593 CTGTGTCCCCACATGGTGGAAGG + Intronic
1170420728 20:16190237-16190259 CTGTGTCACCACATTGTAGAGGG - Intergenic
1170671520 20:18438825-18438847 CTGTGTCTTCATATGGTGGAAGG + Intronic
1170674854 20:18469482-18469504 CTGGGTCTCCAGCTTGCAGAGGG + Intronic
1170946811 20:20898775-20898797 CTGTGTCCTCATATGGTAGAGGG - Intergenic
1171031311 20:21679288-21679310 CTGTGTCCTCACATGGTAGAAGG + Intergenic
1171524866 20:25800936-25800958 CTGTGTCCTCACATGGCAGAAGG + Intronic
1171551961 20:26054947-26054969 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1171793071 20:29546247-29546269 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1171855380 20:30338159-30338181 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1172097347 20:32466925-32466947 CTGTGCCTCCTGGTGGGAGAGGG + Intronic
1172606318 20:36216681-36216703 CTGTGAATCCAGCTTGAAGAAGG + Intronic
1172745511 20:37204800-37204822 GTGTATCTCCAGTTTGAAGAAGG + Exonic
1173580090 20:44140996-44141018 CTGTCTCTCCATCTGAAAGATGG + Intronic
1173881278 20:46414350-46414372 CTGTGTCTTCACGTGGCAGAAGG + Intronic
1173904806 20:46618593-46618615 CTGTGTCCTCACATGGCAGAAGG - Intronic
1175048139 20:56126636-56126658 CTGTGTCTTCATATGGTGGAAGG - Intergenic
1175051945 20:56163943-56163965 CTGTGTCACCAGATGGTGGAGGG - Intergenic
1175169118 20:57067601-57067623 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
1175181742 20:57153319-57153341 GTGTGTCTTCACATGGTAGATGG - Intergenic
1175996568 20:62814669-62814691 CTGTGCCACCAGATGGGAGCTGG - Intergenic
1176037353 20:63046172-63046194 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1176132300 20:63501359-63501381 CTGTGTCCTCACATGGGAGAAGG - Intergenic
1176180058 20:63745598-63745620 CTGTGCCTTCAGATGGGAGGTGG - Exonic
1177006246 21:15675872-15675894 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1177197341 21:17917329-17917351 CTGGTTCTCCAGCTTGAAGATGG + Intronic
1177201070 21:17956688-17956710 CTGTGTTTTCATATGGCAGAAGG + Intronic
1177208941 21:18045820-18045842 CTGTGTCCTCACATGGCAGAAGG - Intronic
1177224183 21:18232453-18232475 CTGTGTCTCCACATGGTGGAAGG + Intronic
1177394847 21:20520445-20520467 CTGTGTCCTCACATGGTAGAAGG + Intergenic
1177562826 21:22778858-22778880 CTGTGTCTTCACTTGGCAGAAGG + Intergenic
1177693605 21:24542070-24542092 CTGTGTCTTCACATGGCAGAAGG + Intergenic
1178071408 21:28972152-28972174 CTGTGTCCTCACATGGCAGAAGG - Intronic
1178231456 21:30789748-30789770 CTGTGTCCCCACATGGCAAAGGG - Intergenic
1178383192 21:32128687-32128709 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1178608844 21:34062651-34062673 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1178803711 21:35820562-35820584 CTGGGTCTCCAGCTTGCAGAAGG + Intronic
1178818738 21:35955526-35955548 CTGAAACTCCAGAGGGAAGAGGG + Intronic
1178905733 21:36634524-36634546 CTGTGTCCTCACATGGTAGAAGG + Intergenic
1179131496 21:38641290-38641312 CTGTGTCCTCAAATGGTAGAAGG - Intronic
1179149824 21:38800215-38800237 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1179224223 21:39439195-39439217 CTGGCTTTCAAGATGGAAGAAGG + Intronic
1179503279 21:41823085-41823107 CTGTGTCCTCACATGGTAGAAGG - Intronic
1179533933 21:42039318-42039340 CTGTGTCCCCACATGGTGGAGGG + Intergenic
1179722002 21:43321429-43321451 CTGTTTCTCCACATAGAGGATGG + Intergenic
1179935256 21:44599968-44599990 CTAAGTGCCCAGATGGAAGAGGG + Intronic
1180228870 21:46414455-46414477 CTGTGTGTCCAGGAGGAGGAGGG - Intronic
1180228973 21:46414857-46414879 CTGTGTGTCCAGCAGGAGGAGGG - Intronic
1181931941 22:26408858-26408880 CTGTGTCTCAAGAAAGAAAAAGG - Intergenic
1182265845 22:29114536-29114558 CTGTGTCCGCACATGGCAGAGGG - Intronic
1182615883 22:31589948-31589970 CTGAGTCTCCAGCTTGCAGATGG - Intronic
1182757274 22:32690210-32690232 CTGTATCTCCACAGGGTAGAAGG - Intronic
1182817640 22:33180014-33180036 CTGTGTCCTCACATGGCAGAAGG - Intronic
1182820800 22:33214514-33214536 CTGTGTCTCCAAATACATGATGG - Intronic
1183198186 22:36367755-36367777 CTGTGGCTGCACATGAAAGAAGG + Intronic
1184374611 22:44103762-44103784 CTGGCTCTGAAGATGGAAGAAGG + Intronic
1184510478 22:44930446-44930468 CTCTGTCTACAGCTGGAAGCAGG + Intronic
1184559782 22:45255542-45255564 CTGTGTCCTCACATGGCAGAAGG + Intergenic
949154869 3:815752-815774 CTGTGTTTCAAAATGAAAGATGG - Intergenic
949329423 3:2905415-2905437 CTGTGTTTGCACATGGCAGAAGG + Intronic
949416023 3:3814753-3814775 CTGTGTCTTCACATGGCAGAAGG - Intronic
949585362 3:5431668-5431690 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
949681451 3:6519241-6519263 CTGTGTCTTCATCTGGTAGAAGG + Intergenic
949931533 3:9082388-9082410 CTGTGTCTTCACATGGTGGAAGG - Intronic
950407637 3:12814631-12814653 CTGGGACTCCAGAAGGGAGAAGG - Intronic
950699033 3:14727390-14727412 CAGGGGCTCCAGATGGATGATGG - Intronic
951120438 3:18920698-18920720 CTGTGTTTTCAGAAGGAGGAAGG - Intergenic
951247834 3:20361629-20361651 CTCTGTCTCAACATGGTAGAAGG + Intergenic
951480231 3:23153106-23153128 CTGTGTCCTCACATGGTAGAAGG + Intergenic
951811546 3:26706122-26706144 CTGTTTCTTCACATGGCAGAAGG + Intronic
952011422 3:28904527-28904549 CTGTGTCCTCACATGGCAGAAGG + Intergenic
952583526 3:34863999-34864021 CAGTGTCTCCATATGTAAAATGG - Intergenic
952719639 3:36519025-36519047 CTGGGATTCCAGAAGGAAGAGGG + Intronic
952832421 3:37576213-37576235 CTGTGTGCCCAGCTGCAAGAAGG - Intronic
952878132 3:37965313-37965335 CTGTTTTTCCAGCAGGAAGATGG - Intronic
953437879 3:42894159-42894181 CTGTGTCCTCATATGGCAGAAGG + Intronic
953747784 3:45588167-45588189 CTGTGTCCTCACATGGTAGAAGG - Intronic
954463127 3:50638913-50638935 CTGTGTTTCCTAATGGAGGAGGG - Intronic
954608888 3:51933893-51933915 CTGTGTCACCAGGTGGCAGGAGG - Intronic
954615178 3:51965883-51965905 GTGGGTCTCCTCATGGAAGAGGG + Intronic
955165126 3:56503475-56503497 CTGTGTCTTCACATGGTGGAAGG + Intergenic
955241644 3:57183234-57183256 CTGTGTCCTCACATGGCAGAAGG + Intergenic
955369179 3:58336283-58336305 CTGAGTCACCAGAAGGATGAAGG + Intronic
955476864 3:59346302-59346324 CTGTGTCTTCACATGGCACAAGG + Intergenic
955998062 3:64698364-64698386 CTGTGTCATCACATGGCAGAAGG + Intergenic
956271571 3:67453418-67453440 CTGTGTCCTCACATGGCAGAAGG + Intronic
956407421 3:68942475-68942497 CTGAGTCTCCAGCTTGCAGATGG + Intergenic
956448826 3:69352838-69352860 CTTTGCCTCCAGAAAGAAGAAGG - Intronic
956564970 3:70625994-70626016 CTGTGTCCTCACATGGTAGAAGG - Intergenic
956615940 3:71172726-71172748 CAGTGAATCCAGAAGGAAGAGGG - Intronic
956689554 3:71863426-71863448 CTGTGTCCTCACATGGCAGAAGG + Intergenic
956758361 3:72412967-72412989 CTGTGTCCTCACATGGCAGAAGG - Intronic
956766574 3:72489299-72489321 CTGTGTCTTCATCTGGAAAATGG - Intergenic
956919189 3:73908274-73908296 CTGTGTCCTCACATGGCAGAAGG - Intergenic
957144054 3:76398869-76398891 CTGAGTATGAAGATGGAAGAAGG + Intronic
957310304 3:78510337-78510359 CTGTGTCCTCACATGGCAGAAGG + Intergenic
958069905 3:88596915-88596937 CTGTGTCCTCACATGGCAGAAGG - Intergenic
958187185 3:90136934-90136956 CTGTTTCTCCAGTTTGCAGATGG - Intergenic
958189395 3:90165586-90165608 CTGTGTCCTCACATGGTAGAAGG + Intergenic
958662477 3:97088561-97088583 CTGTGTCTTCAGGTGCAGGAAGG - Intronic
958686799 3:97408670-97408692 CTGTGTCCTCACATGGCAGAAGG + Intronic
959017736 3:101154831-101154853 CAGGGTCTCCAGCTGGCAGATGG - Intergenic
959051489 3:101528787-101528809 CTGTGTCTTCACATGGCAGATGG - Intergenic
959470382 3:106742740-106742762 ATGTGTCCTCAGATGGAAGAAGG + Intergenic
959492474 3:107007157-107007179 CTGTGTCACTACATGGCAGAAGG + Intergenic
959568006 3:107852501-107852523 CTGTGTCCTCCCATGGAAGAAGG - Intergenic
959569318 3:107866400-107866422 CTGCGTCTTCACATGGCAGAAGG - Intergenic
959585762 3:108023691-108023713 CTGAGTATCCAGATTGAGGAGGG - Intergenic
959585793 3:108023953-108023975 CTGGCTCTGAAGATGGAAGAAGG + Intergenic
959877046 3:111395378-111395400 CTGTGTCTTCACATGGTGGAAGG - Intronic
959885808 3:111498054-111498076 CTGATTCTTCAGATGGAAGGTGG - Intronic
960078826 3:113518764-113518786 CTGTGTCTTCACATAGCAGAAGG - Intergenic
960126159 3:114000421-114000443 TTGGGTCTCCAGATGGCAGATGG + Intronic
960633343 3:119755528-119755550 CTGTGTCTTCACATTGAAGATGG - Intronic
960972669 3:123150706-123150728 CAGTGTCTGGAGAAGGAAGAGGG - Intronic
961121385 3:124374143-124374165 CTGTGTCTTTATATGGTAGAAGG - Intronic
961689227 3:128656416-128656438 CTGGGTGTTCATATGGAAGAAGG + Intronic
962016653 3:131447932-131447954 ATGTGTCTTCACATGGAAAAAGG + Intergenic
962123978 3:132595097-132595119 CTGGGAGTCCAGATGGATGAGGG + Intronic
962324679 3:134423262-134423284 TTGTGTTGCCTGATGGAAGAGGG + Intergenic
962455119 3:135558050-135558072 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
962493904 3:135920571-135920593 CTATTTTTCCAGATGGAAGAGGG - Intergenic
962577858 3:136771102-136771124 CTGTGTCCTCATATGGAGGAAGG - Intergenic
962842090 3:139243298-139243320 CTGTGTCTTCACATGGTAGAAGG + Intronic
963335225 3:143967496-143967518 CTGTGTCTTCGCATGGCAGAAGG - Intergenic
963390779 3:144661094-144661116 CTGTGTCTTCACATGGTGGAAGG + Intergenic
963462791 3:145638175-145638197 CTGTGTCTTCACATGGTGGAAGG - Intergenic
963538258 3:146555486-146555508 TTGTGTCTCCAGCTTGCAGATGG - Intergenic
963896783 3:150694968-150694990 CTGTGTCCTCACATGGTAGAAGG + Intronic
963908427 3:150793774-150793796 CTGTGTCCTCACATGGTAGAAGG - Intergenic
964164408 3:153684811-153684833 CTGAGTCTCCAGCTTGCAGATGG + Intergenic
964441855 3:156719398-156719420 CTGTGTTTTCACATGGCAGAAGG - Intergenic
966008462 3:175047023-175047045 CTGTGTCCTCAGATGGTGGAAGG + Intronic
966226698 3:177605515-177605537 CTGTGTCCTCACATGGTAGAAGG - Intergenic
966288750 3:178329581-178329603 CTGTGTCCTCACATGGCAGAAGG + Intergenic
966485045 3:180459477-180459499 CTGGGTCTCCAGCTTGCAGAGGG - Intergenic
966497295 3:180595715-180595737 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
966682465 3:182657335-182657357 CTGTGTCTTTACATGGCAGATGG + Intergenic
967042408 3:185705753-185705775 CTGTGTCTCTGGATGGAGGAAGG + Intronic
967226147 3:187293255-187293277 CTGTGTCTTCATTTGGAAAATGG + Intergenic
967260698 3:187638921-187638943 CTGTGTCTTCACATGGCAAAAGG + Intergenic
967719608 3:192801606-192801628 CTGTGTCCTCACATGGCAGAAGG - Intronic
968624742 4:1622055-1622077 CTGTGTCGTCAGGTGGCAGAGGG - Intronic
968716887 4:2166842-2166864 CTGGGTCTCCAGCTTGAAGAAGG + Intronic
968733218 4:2281477-2281499 CTATGTCACCACATGGAGGAAGG + Intronic
968799949 4:2736129-2736151 CTGTATCTTCATATGGTAGAAGG + Intergenic
968926745 4:3552340-3552362 CTGTGTCATCACATGGCAGAAGG - Intergenic
969664374 4:8548624-8548646 CTGGGTCTCCAGGTTGCAGACGG + Intergenic
970162718 4:13205358-13205380 CTGTGTCCTCACATGGCAGAAGG + Intergenic
970207312 4:13667952-13667974 CTGTGTCTCCACATGGTGGAAGG + Intergenic
970249579 4:14100076-14100098 CTGGGTCTCCAGCTTGTAGAAGG + Intergenic
970467889 4:16345969-16345991 CTGTCTTTGAAGATGGAAGAAGG - Intergenic
970471350 4:16382238-16382260 CTGTGTCTTCACATGGCAAATGG - Intergenic
970550673 4:17177960-17177982 CTGTGTCCTCACATGGAGGAAGG + Intergenic
970701108 4:18739718-18739740 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
970705400 4:18795508-18795530 CTGTGTCACAACATGGTAGAGGG + Intergenic
970858793 4:20678298-20678320 CTGTGTGTTCACATGGCAGAAGG + Intergenic
970871282 4:20819775-20819797 CTGTGTCCTCACATGGTAGAAGG - Intronic
970964564 4:21913404-21913426 CTGTGTCCTCACATGGCAGAAGG - Intronic
971047182 4:22817790-22817812 CTGTGTCCTCATATGGCAGAAGG - Intergenic
971059470 4:22951428-22951450 ATGTGTTTCCAGGTGGTAGAGGG - Intergenic
971077595 4:23167894-23167916 CTGTGTCTTCACATGGCAGAAGG + Intergenic
971517462 4:27506235-27506257 GTCAGTCTGCAGATGGAAGATGG - Intergenic
971629318 4:28969340-28969362 CTGTGTCTTCATCTGGCAGAGGG - Intergenic
971740196 4:30509492-30509514 CTGTGTCTCCAGCTTGCAAATGG + Intergenic
972131629 4:35842957-35842979 CTGTGTCCCCACATGTCAGAAGG + Intergenic
972181369 4:36470847-36470869 CTGTGTCCTCACATGGCAGAAGG - Intergenic
972847704 4:43009650-43009672 CTGTGTCATCACATGGTAGAAGG + Intronic
972992201 4:44834530-44834552 CTGTGTCTTCACATAGAAAAAGG + Intergenic
973062862 4:45750927-45750949 CTGTGTCCTCACATGGCAGAAGG + Intergenic
973263030 4:48183691-48183713 CTGTGTCTCCACATTGCAGATGG + Intronic
973542067 4:51944835-51944857 ATGTGTCTTCACATGGCAGATGG + Intergenic
973558504 4:52110143-52110165 CTGTGTCCTCATATGGCAGAGGG - Intergenic
973735990 4:53872194-53872216 CTGTGTCTCCACATGAAAAAAGG - Intronic
973758227 4:54095356-54095378 CTGTGGGTCAAGATGAAAGAGGG - Intronic
973766126 4:54164670-54164692 CTGTGTCCTCACATGGCAGAAGG + Intronic
973969239 4:56194644-56194666 CTGTGTCTTCATGTGGCAGAAGG - Intronic
974202033 4:58655152-58655174 CTGTGTCCTCACATGGCAGAAGG + Intergenic
974205613 4:58699404-58699426 ATGTATATCCAAATGGAAGAAGG - Intergenic
974308821 4:60176566-60176588 CTGAGTCCTCACATGGAAGAAGG - Intergenic
974525663 4:63047116-63047138 CCGTGTCTTCAAATGGGAGAAGG + Intergenic
974551996 4:63387954-63387976 CTGTGTCCTCATATGGTAGAGGG + Intergenic
974821462 4:67071374-67071396 CTGTGTCCTCACATGGCAGAGGG - Intergenic
974837285 4:67266227-67266249 CTGTGTCCTCAGGTGGCAGAAGG + Intergenic
975224218 4:71851703-71851725 CTGTGTCTTCACATAGACGAAGG + Intergenic
975241840 4:72068329-72068351 CTGTGTCCTAAGATGGCAGAAGG + Intronic
975385327 4:73751567-73751589 AGGTGTTTCCAGATGGAAGTGGG + Intergenic
975764119 4:77649394-77649416 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
975974777 4:80082195-80082217 CTGTGTCCTCAGATGGCAGAAGG + Intronic
976125495 4:81829813-81829835 CTGTGTCTCCAGGCTGCAGATGG - Intronic
976224891 4:82788096-82788118 CTGTGTCTTCACATGGCAAAAGG - Intronic
976437341 4:85033285-85033307 CTGTGTCATCACATGGTAGAAGG + Intergenic
976468107 4:85394667-85394689 CTGTGTCATCACATGGCAGAAGG + Intergenic
976626595 4:87190830-87190852 TTGTGTCTTCAGATGGTGGAAGG + Intronic
976666568 4:87600562-87600584 CTGAGTCTTCACATGGTAGAAGG - Intergenic
976894882 4:90097367-90097389 CTGTGCCTTCACATGGCAGAAGG + Intergenic
976929811 4:90552007-90552029 CTGTGTCCCCACATGGAGAAAGG + Intronic
977191069 4:94001331-94001353 CTGTGTCCTCACATGGTAGAAGG + Intergenic
977239792 4:94554180-94554202 CATTGTCTCTGGATGGAAGATGG - Intronic
977423716 4:96837919-96837941 CTGTATCTTAACATGGAAGAAGG - Intergenic
977490705 4:97706427-97706449 CTGTGTCCTCACATGGCAGAAGG - Intronic
977582794 4:98743927-98743949 CTGTGTCTTCACGTGGCAGAAGG + Intergenic
977603765 4:98961474-98961496 CTGTGTCTTCACATGGAGGAAGG - Intergenic
977748467 4:100579864-100579886 CTGTGTCCTCACATGGCAGAAGG - Intronic
977748602 4:100581009-100581031 CTGTGTCCTCACATGGCAGAAGG - Intronic
977880495 4:102198942-102198964 CTGTGTCCTCACATGGCAGAAGG + Intergenic
978204460 4:106063792-106063814 CTGTGTCTTCATGTGGAAGAAGG - Intronic
978367934 4:108002122-108002144 CTGTGTCCTCATATGGCAGAAGG - Intronic
978495906 4:109358769-109358791 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
978579003 4:110213994-110214016 CTGGGTCTCCAGCTTGTAGATGG - Intergenic
978863628 4:113480885-113480907 CTGTGTCTTCACATGGCAGAAGG - Intronic
979069559 4:116184920-116184942 CTGTATCTTCACATGGTAGAAGG - Intergenic
979174388 4:117644490-117644512 CTGTGTCCTCACATGGCAGAAGG + Intergenic
979366506 4:119830806-119830828 CTGTGTCTTCACATGGTAGAAGG - Intergenic
979616419 4:122747687-122747709 CTGTGTCTTCACATGGCAGAAGG - Intergenic
979824011 4:125210619-125210641 CTGTGTCATCACATGGGAGACGG + Intergenic
980169044 4:129264702-129264724 CTGTGTCTTCACATGGTAGAAGG + Intergenic
980380180 4:132003683-132003705 CTGTGTCTTCATATGACAGAAGG + Intergenic
980535194 4:134111166-134111188 CTGTGTCTTCACAAGGCAGAAGG + Intergenic
980614588 4:135202332-135202354 CTGTGTCCTCACATGGAGGAAGG - Intergenic
980662324 4:135878579-135878601 CTGTGTCCTCACATGGCAGAAGG - Intergenic
980828897 4:138105726-138105748 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
980991889 4:139745281-139745303 CTGTGGCTCCTGATGGACGGTGG - Intronic
981377559 4:144033419-144033441 CTGTGTCCTCACATGGCAGAAGG - Intergenic
981743071 4:148023392-148023414 CTTTGTCTGGAGCTGGAAGATGG + Exonic
981890560 4:149731300-149731322 CTGTGTCTTCACATGGTGGAAGG - Intergenic
982344233 4:154339073-154339095 CTATGTCTCCAGCTTGCAGATGG - Intronic
982572545 4:157068495-157068517 CTGTGTCTTCACATGGAGGAAGG + Intergenic
982951193 4:161698147-161698169 CTGTGTCCTCACATGGCAGAAGG - Intronic
983123593 4:163920248-163920270 CTATGTTTCCAGCTGGAATAGGG - Intronic
983500638 4:168495397-168495419 CTGTGTCCTCACATGGCAGAAGG - Intronic
983826526 4:172268789-172268811 CTGTGTTCTCACATGGAAGAGGG - Intronic
984315299 4:178122065-178122087 CTATATCTCCAGAAGGAAGAGGG + Intergenic
984337478 4:178411175-178411197 TTGTGTCTGCACATGGAAGAAGG - Intergenic
984585527 4:181560207-181560229 CTGTGGCTTCACATGGCAGAAGG + Intergenic
984620206 4:181944191-181944213 CTGGGGCTCCAGCTGGCAGATGG - Intergenic
984863387 4:184259187-184259209 CTGTGTCCTCACATGGCAGAAGG - Intergenic
984900649 4:184583230-184583252 CTGTGTCCTCACATGGCAGAAGG - Intergenic
985254736 4:188058473-188058495 CTGTGTCCTCACATGGCAGAAGG + Intergenic
986374669 5:7117826-7117848 CTGTGTCCTCAGATAGCAGAAGG - Intergenic
986535650 5:8784129-8784151 CTGTGTCCTCACATGGCAGAAGG - Intergenic
986666931 5:10112685-10112707 CTGTGTCTGCACATGGTAGAAGG + Intergenic
986969098 5:13311239-13311261 CTAGTTCTCCAGCTGGAAGATGG - Intergenic
987436994 5:17906587-17906609 CTGTGTCTTCACATGGTGGAAGG - Intergenic
987575842 5:19726932-19726954 CTGTGTCATCATATGGCAGAAGG - Intronic
987724999 5:21686453-21686475 CTGTGACTCCAGATGTGTGATGG - Intergenic
987941351 5:24542785-24542807 CTGTGTCTTCACATGGCAGAAGG + Intronic
988063455 5:26203587-26203609 CTGTGTCTTCACATGGCAGAAGG - Intergenic
988288567 5:29254896-29254918 CTGTGTCCTCACATGGCAGAAGG + Intergenic
988673297 5:33405444-33405466 CTGTGTCCTCAGATAGTAGAAGG - Intergenic
988704929 5:33716194-33716216 CTGTGTCTCCACATGGTAGAAGG - Intronic
988802736 5:34711657-34711679 CTGTGTCCTCATATGGCAGAAGG - Intronic
989154823 5:38334419-38334441 CTGTGTCTTCACATAGCAGAAGG + Intronic
989503952 5:42203506-42203528 CTGTGTCCTCACATGGTAGAAGG - Intergenic
989734761 5:44690501-44690523 CTGTGTCCTCACATGGAGGAAGG + Intergenic
990334779 5:54761846-54761868 CTGTGTCTTCAGGGGGAAGAAGG + Intergenic
990373127 5:55141339-55141361 CTGTCTTTGCAGATGGATGAGGG - Intronic
990532046 5:56683821-56683843 CTGTGTCTTCACATGGCAGAAGG - Intergenic
990559259 5:56967160-56967182 CTGTGTCCTCAAATGGTAGAAGG - Intronic
990697283 5:58434316-58434338 CTGTGTCCTCACATGGTAGAAGG - Intergenic
990806228 5:59665811-59665833 CTGTGTCCTCACTTGGAAGAAGG - Intronic
990962718 5:61411727-61411749 CTGTGTCTTCATGTGGTAGAAGG + Intronic
991108997 5:62876346-62876368 CTGGGTCTCCAGCTTGCAGACGG + Intergenic
991514851 5:67424000-67424022 CTGTGTCCTCACATGGCAGAAGG - Intergenic
992034815 5:72762643-72762665 CTGGGCCTCCAGATTGCAGATGG - Intergenic
992261205 5:74972082-74972104 CTGTGTCTTCATATGGCAGAAGG - Intergenic
992673673 5:79084211-79084233 CTGTGTCCTCACATGGTAGATGG + Intronic
992845108 5:80738914-80738936 GTGTGTCTTCACATGGAGGAGGG - Intronic
993021904 5:82602114-82602136 CTGTGTCCTCAAATGGCAGAAGG + Intergenic
993023362 5:82618478-82618500 CTGTGTCCTCACATGGCAGAAGG + Intergenic
993106275 5:83604510-83604532 CTGTGTCTCCAGGTTGTAGATGG + Intergenic
993164584 5:84335927-84335949 CTGTTTCCTCAGATGGAGGAAGG + Intronic
993354932 5:86894118-86894140 CTGTGTCATCACATGGCAGAAGG - Intergenic
993453863 5:88105088-88105110 CTGTGTATTCACATGGTAGAAGG - Intergenic
993593296 5:89822940-89822962 CTGTGTCTTCACATGGTAGAAGG - Intergenic
993596498 5:89863297-89863319 CTGTTTCTCCAGTTTGCAGAAGG - Intergenic
993907222 5:93636490-93636512 CTGTGTCTTCACAGGGAAGAAGG - Intronic
994052856 5:95382051-95382073 CTGTGTCTTCACATGGCAGAGGG + Intergenic
994252917 5:97557811-97557833 CTGTGTCCTCACATGGTAGAAGG - Intergenic
994440456 5:99796626-99796648 CAGTGTCTCCAGCTTGCAGATGG + Intergenic
994810229 5:104507871-104507893 CTGTGTCCTCACATGGTAGAAGG - Intergenic
994908725 5:105873746-105873768 TTGTGTCTTCAAATGGCAGAGGG + Intergenic
994958950 5:106572935-106572957 CTGTGTTACCACATGGCAGAAGG - Intergenic
995257405 5:110062921-110062943 TTTAGTCTCCAGATGGAATATGG + Intergenic
995350285 5:111167127-111167149 CTGTGTCTTCACATTGCAGAAGG - Intergenic
995368344 5:111389176-111389198 CTGTGTCTGCACATGGTGGAAGG + Intronic
995377746 5:111495388-111495410 CTGTGTCCTCATATGGCAGAAGG + Intergenic
995399131 5:111720735-111720757 CTGGGTCTCCAGCTTGAAGATGG + Intronic
995514096 5:112937120-112937142 CTGTGTCCCCACATGGCAGAAGG - Intergenic
995755482 5:115499190-115499212 CTGTGTCCTCACATGGCAGAAGG + Intergenic
996269393 5:121584767-121584789 CTGTATCTCTACATGGCAGAGGG + Intergenic
996492301 5:124111943-124111965 CTTTGTTCCCAGAAGGAAGAAGG - Intergenic
996528830 5:124505641-124505663 ATGTATCTCCAGTTGAAAGAAGG - Intergenic
997002642 5:129780679-129780701 CTGGGTCTTCAGCTGGCAGATGG + Intergenic
997101547 5:130974722-130974744 CTGTGTTTCTAAATGGAATATGG - Intergenic
997132711 5:131293233-131293255 CTGTATCTTCACATGGTAGAAGG - Intronic
997179893 5:131817241-131817263 CTGGTTCTCCAGCTGGCAGATGG + Intronic
997242043 5:132314854-132314876 CAGTGTCTGCAGAGGGGAGAAGG + Intronic
997385805 5:133471519-133471541 CTGTGTCCTCACATGGCAGAAGG - Intronic
998388144 5:141770131-141770153 CTGTGTCTTCACATGGCAGAAGG + Intergenic
998725213 5:145004861-145004883 CTGGTTCTCCAGCTTGAAGATGG - Intergenic
999122212 5:149218279-149218301 CTGTGTCTCCACATGGTGGAAGG + Intronic
999217165 5:149944889-149944911 CTGTGGGGCCAGATGGGAGAAGG + Intergenic
999754961 5:154657430-154657452 TTGGGTCTCCAGCTGGAACAAGG - Intergenic
999780469 5:154845724-154845746 CTGTTTCTTCAGTTGGAAAATGG - Intronic
999877399 5:155823213-155823235 CTGGGTCTCCAGCTTGGAGAAGG - Intergenic
1000966044 5:167658161-167658183 CTGTGTCCTCACATGGCAGATGG + Intronic
1001137200 5:169112480-169112502 CAGAGCCTCCAGATGGAAGAAGG - Intronic
1001335338 5:170791927-170791949 CTGTGTCATCAGATGGTGGAAGG + Intronic
1001441585 5:171747934-171747956 CTGTGTCTTCTCATGGTAGAAGG + Intergenic
1001670490 5:173469452-173469474 CTGTCTCTGTGGATGGAAGAGGG - Intergenic
1001728008 5:173924086-173924108 ATGTTTCTACAGATGGAGGAAGG - Intronic
1001814271 5:174654928-174654950 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1002119400 5:176990305-176990327 CTGTGTCTTCACATGGCAGAAGG - Intronic
1002592139 5:180298181-180298203 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1002613972 5:180438912-180438934 CTGTGTCTTCTCATGGCAGAAGG - Intergenic
1002783643 6:385047-385069 CTGTGTGTACTGATGGAAAATGG + Intergenic
1002883979 6:1277496-1277518 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1003193033 6:3890843-3890865 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1003201459 6:3965088-3965110 CTGTGTCTTCACATGGTGGAAGG - Intergenic
1003601142 6:7518675-7518697 CTGGGTTCCCTGATGGAAGAGGG - Intergenic
1003692060 6:8364731-8364753 CTGTGTCCTCATATGGAAGAAGG - Intergenic
1003692068 6:8364779-8364801 CTGTGTCCTCATATGGAAGAAGG - Intergenic
1003692074 6:8364814-8364836 CTGTGTCCTCATACGGAAGAAGG - Intergenic
1004050747 6:12076540-12076562 CTGTGTCTTCACATGGAGGAAGG + Intronic
1004308509 6:14522893-14522915 CTGAGTCTCCAGGTTGCAGATGG - Intergenic
1004371811 6:15059342-15059364 CTGTGTCTTCATATGGCAGAAGG + Intergenic
1004475602 6:15968322-15968344 CTGGGGCTGCAGAAGGAAGATGG + Intergenic
1004823194 6:19392499-19392521 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1004826314 6:19425321-19425343 CTGTGTCCTCACATGGAAGAAGG + Intergenic
1004971752 6:20918153-20918175 CTGTGTCCTCACATGGCAGAAGG - Intronic
1005095461 6:22110022-22110044 CTGTGACTCCAGCTTGGAGAGGG - Intergenic
1005316105 6:24604268-24604290 CAATGGCTGCAGATGGAAGATGG - Intronic
1005827095 6:29639433-29639455 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1006330478 6:33386757-33386779 CTGTGTCCTCACATGGTAGAAGG - Intergenic
1006912347 6:37571602-37571624 CTATGTCCCCAACTGGAAGAAGG + Intergenic
1007061409 6:38944224-38944246 CTCTGTCTCCAGGTTGCAGAGGG + Intronic
1007076123 6:39067454-39067476 CTGTGTCCTCACATGGCAGAGGG + Intronic
1007164520 6:39819788-39819810 CTGTGTCCTCACATGGCAGATGG + Intronic
1008402474 6:51079600-51079622 CTGTTTCTTCATATGGAAAAGGG + Intergenic
1008417862 6:51264231-51264253 TTGTGTCTTCACATGGTAGAAGG - Intergenic
1008614813 6:53216472-53216494 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1008615552 6:53222277-53222299 CTGTGTCTTCACATGGCAGAAGG - Intergenic
1008946363 6:57101374-57101396 CTGTGTCCCATGAAGGAAGAAGG - Intronic
1009034110 6:58095885-58095907 CTGGTTCTCCAGCTTGAAGAAGG - Intergenic
1009747580 6:67838508-67838530 CTGTGTCCTCACATGGTAGAGGG + Intergenic
1010145155 6:72659607-72659629 CTGTGTCCTCACGTGGAAGAAGG + Intronic
1010247454 6:73674784-73674806 CTGTGTCTTCACATGATAGAAGG - Intergenic
1010473652 6:76261052-76261074 CTGTGTCCTCATATGGCAGAAGG - Intergenic
1010652971 6:78477730-78477752 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1010662955 6:78592630-78592652 CTGGGTCTCCAGTTTGAAGATGG - Intergenic
1011073264 6:83409063-83409085 CTGTGTCCTCACATGGCAGAAGG - Intronic
1011133501 6:84075286-84075308 CTGTGTATCCAGAAGGAAAGAGG + Intronic
1011441314 6:87390609-87390631 CTGTGTCTTCACATGGTAGAAGG + Intronic
1011738939 6:90340121-90340143 CTGGTTCTCCAGATTGCAGATGG + Intergenic
1011889597 6:92140736-92140758 CTGTGTCTTCCCATGGTAGAAGG - Intergenic
1012065753 6:94549423-94549445 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1012471579 6:99578485-99578507 CTGGATCTCCAGCTTGAAGATGG - Intergenic
1013339775 6:109202256-109202278 CTGTGTCCGCACATGGTAGAAGG + Intergenic
1013470034 6:110455841-110455863 CAGTGTCCTCACATGGAAGAAGG - Intronic
1013630016 6:111977254-111977276 CTGTGTCCTCACATGGTAGAAGG - Intergenic
1013675697 6:112459396-112459418 CTGTGTCCTCATATGGTAGAAGG - Intergenic
1013692615 6:112663798-112663820 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1013786708 6:113789441-113789463 CTGTGTCCTCACATGGTAGAAGG + Intergenic
1013823696 6:114185355-114185377 CTGTGTCTTCACATGGCAGAAGG - Intronic
1013961164 6:115902099-115902121 CAGCAGCTCCAGATGGAAGATGG + Intergenic
1013996063 6:116309766-116309788 CTGTGTCTTCATATGGCAGAAGG + Intronic
1014941043 6:127439033-127439055 CTGTGTCTTTATATGGCAGAAGG - Exonic
1015187088 6:130430212-130430234 CTGTGTCCTCACATGGTAGAAGG + Intronic
1015210110 6:130687242-130687264 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1015389407 6:132664307-132664329 CTGTGTCCTCACATGGTAGAAGG - Intergenic
1015519820 6:134118918-134118940 CAGAGTCTCCAGATTGCAGATGG - Intergenic
1015606389 6:134959311-134959333 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1015840980 6:137476963-137476985 CTGTGTCTTCACATGGCAGAAGG - Intergenic
1015966237 6:138697281-138697303 AAGTGACTGCAGATGGAAGAGGG - Intergenic
1016158971 6:140852357-140852379 CTGGGTCTCCAGCTTGCAGAGGG - Intergenic
1016265397 6:142227390-142227412 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1016388040 6:143548172-143548194 CTGTGTCCTCACATGGCAGAGGG + Intronic
1016705223 6:147099309-147099331 GTGTGTGTGCAGAAGGAAGATGG - Intergenic
1017186969 6:151611464-151611486 CTGTGTCTTCACATGGTAGAAGG + Intronic
1017192372 6:151668230-151668252 CTGTGTCCTCATATGGCAGAAGG + Intronic
1017341604 6:153330656-153330678 CTGTATGTTCAGATGGAAGATGG + Intergenic
1017984576 6:159432393-159432415 CTCTATCTCTTGATGGAAGAGGG + Intergenic
1018122726 6:160652566-160652588 ATGTGACTCCAGATGGAAATTGG + Intronic
1018225870 6:161628377-161628399 CTGTGTCTTCACACGGCAGAAGG + Intronic
1018234900 6:161714419-161714441 CTGTGTCTTCACATGGCAAAAGG - Intronic
1018641873 6:165911478-165911500 CTGTGTAACCAGATGAAAGTTGG - Intronic
1018805141 6:167253462-167253484 CTGTGTCCTCACATGGCAGAGGG + Intergenic
1018805444 6:167255830-167255852 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1019161213 6:170068029-170068051 CTGTCTCTGCAGATGGGACAGGG + Intergenic
1019398945 7:840090-840112 CTTTCTCTCGAGAAGGAAGACGG + Intronic
1019760676 7:2810261-2810283 CTGTGTCCTCAGATGGTGGAAGG + Intronic
1019967877 7:4514826-4514848 CTGTGTCTTCACATTGTAGAAGG + Intergenic
1020168098 7:5823652-5823674 CTGGGTCTCTAGGGGGAAGAAGG + Intergenic
1020883454 7:13793103-13793125 CAGAGTCTCCAGCTTGAAGATGG + Intergenic
1021412795 7:20347057-20347079 CTGTGTCTTCATATGGCAGAAGG - Intronic
1021940071 7:25670301-25670323 CTGGCTCTCTAGATGGGAGAGGG - Intergenic
1021976937 7:26020223-26020245 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1022150292 7:27596222-27596244 CTGTGTCCTCACATGGCAGAAGG + Intronic
1022212470 7:28224970-28224992 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1022260850 7:28703537-28703559 CTGGGTCTCCAGCTGGCAGATGG - Intronic
1022407195 7:30101482-30101504 CTGTGTCCTCACATGGAGGAAGG + Intronic
1022421719 7:30229781-30229803 TTGTGTCTTCACATGGCAGAAGG + Intergenic
1022421722 7:30229808-30229830 TTGTGTCTTCACATGGCAGAAGG + Intergenic
1022421725 7:30229835-30229857 TTGTGTCTTCACATGGCAGAAGG + Intergenic
1022950017 7:35329208-35329230 CTGTGTCTTCACATGATAGAGGG - Intergenic
1023539586 7:41251222-41251244 CTGTGTCCTCACATGGTAGAAGG + Intergenic
1023603471 7:41904467-41904489 CTGTGTCTTCACATGGCAGAAGG - Intergenic
1023770418 7:43551891-43551913 CTGTGTCTTCATGTGGAGGAAGG + Intronic
1023988877 7:45115997-45116019 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1024132021 7:46362773-46362795 CTGTGTCCTCATATGGCAGAAGG - Intergenic
1024207721 7:47178072-47178094 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
1024273016 7:47656568-47656590 CTGTGTCTTCACATGACAGAAGG - Intronic
1024783370 7:52877624-52877646 CTCTGTCTTCACATGGTAGAAGG + Intergenic
1025285527 7:57657536-57657558 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1025300616 7:57817236-57817258 CTGTGTCCTCACATGGTAGAAGG - Intergenic
1025887896 7:65615578-65615600 CTGTGTCCTCACATGGCAGATGG + Intergenic
1026248015 7:68640089-68640111 CTGTGTCTTCACATGGTAGAAGG - Intergenic
1026443405 7:70463089-70463111 GTGAGTCTCCAGATGAAAGGTGG + Intronic
1026818542 7:73531024-73531046 CTGTATCTTCACATGGCAGAAGG + Intergenic
1027453606 7:78360707-78360729 CTGTCCCTCCTGCTGGAAGAGGG - Intronic
1027673749 7:81133763-81133785 CTGTGTCCTCACATGGTAGAAGG + Intergenic
1027695728 7:81407823-81407845 CTGTGTCTTCACATGGTGGAAGG - Intergenic
1027756105 7:82214019-82214041 CTGTGTCCCCACATGGTTGAAGG + Intronic
1027830219 7:83167330-83167352 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
1027879983 7:83822344-83822366 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
1028210581 7:88069274-88069296 CTGTGTCATCATATGGTAGAAGG - Intronic
1028776839 7:94687284-94687306 CTGTGTCCTCATATGGCAGAAGG + Intergenic
1028882821 7:95899240-95899262 CTCTGTCTCCAGATGTAACATGG - Intronic
1028906519 7:96160560-96160582 CTGTGTCCTCACATGGAGGAAGG + Intronic
1029489203 7:100861278-100861300 CTGTGTCCCCAGAGAGAAGAAGG + Intronic
1029502373 7:100939888-100939910 CTGTGTCTTCACATGGTAGAAGG - Intergenic
1029662345 7:101971091-101971113 CAGTCTCCCCAGATGGAAAATGG - Intronic
1030078335 7:105755886-105755908 CTGTGTCTCCACCTGCATGACGG - Intronic
1030203446 7:106929056-106929078 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1030662362 7:112234396-112234418 CTGTGTCTTTACATGGCAGAAGG + Intronic
1030776811 7:113543663-113543685 CTGTGTCTTCACATGGTGGAAGG - Intergenic
1030814866 7:114023454-114023476 CTGTGTCCTCAAATGGCAGAAGG + Intronic
1030941212 7:115651627-115651649 CTGTGTCTCCAAATGGCAAAGGG - Intergenic
1031013728 7:116550247-116550269 CAGGGTTTCAAGATGGAAGAGGG - Intronic
1031043456 7:116862593-116862615 GTTTGTCGCCAGAAGGAAGATGG + Exonic
1031203447 7:118721863-118721885 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1031305834 7:120125826-120125848 CTGTGTCTTCATATGGAGGAAGG - Intergenic
1031349108 7:120706455-120706477 CTGTGTCTTCACATGGCAGAAGG + Intronic
1031606302 7:123772088-123772110 CTGAGTCTCCAGCTTGCAGATGG + Intergenic
1031624840 7:123980437-123980459 TTGTGTCCTCACATGGAAGAAGG + Intergenic
1031854493 7:126906160-126906182 CTGTGTCCTCACATGGCAGATGG - Intronic
1032357636 7:131225277-131225299 CTGTGTCTCCACATGGTGGAAGG + Intronic
1032802780 7:135329741-135329763 CTGTGTCCCCACAAAGAAGAGGG - Intergenic
1032841525 7:135717789-135717811 ATGTCTGTCCAGATGGCAGAGGG - Intronic
1032932078 7:136684492-136684514 CTGTGTCCTTACATGGAAGAAGG + Intergenic
1033074949 7:138240118-138240140 CTGTGCGGCCAGAAGGAAGATGG + Intergenic
1033366521 7:140676200-140676222 CTGTGTCATCACATGGTAGAAGG + Intronic
1033579721 7:142721065-142721087 CAGTGTCTCTAGAGAGAAGAAGG + Intergenic
1033865414 7:145685716-145685738 TTGTGTCCCCAGTGGGAAGAAGG + Intergenic
1033980219 7:147155221-147155243 CTGTGTCCTCACATGGCAGAAGG - Intronic
1034275514 7:149822150-149822172 CTGGGTGTCCAGGTGGAGGAAGG - Intergenic
1034362254 7:150510311-150510333 CTGTGTCCCCACATGGTGGAAGG - Intergenic
1034716448 7:153247053-153247075 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1035032161 7:155868442-155868464 CTGTTTAGCCAGAAGGAAGAGGG + Intergenic
1035055293 7:156031256-156031278 CTGAGTCTCCAGTGGGCAGAAGG - Intergenic
1035088369 7:156281359-156281381 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1035187164 7:157135542-157135564 CTGTGTCTCCCCATGGCAGGAGG + Intergenic
1035478340 7:159159502-159159524 CTGTCTTTCCAGATGGAACTGGG - Intergenic
1036161794 8:6395872-6395894 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1036911754 8:12763376-12763398 CTGTATCCCCACATGGAAGAAGG + Intergenic
1037182414 8:16023766-16023788 CTGTGTCTCCAGCTTGCAGATGG - Intergenic
1037432277 8:18826239-18826261 CTGGGTCTCCAGCTCGCAGATGG + Intronic
1037545901 8:19922001-19922023 CTGGGTCTCCAGCTTGCAGATGG + Intronic
1037586914 8:20283344-20283366 CTATGTCTTCAGATGGTGGAAGG - Intronic
1038074848 8:24060547-24060569 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1038393708 8:27230950-27230972 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
1038841435 8:31188075-31188097 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1039575523 8:38620689-38620711 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
1039883481 8:41641933-41641955 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1040350361 8:46560598-46560620 CTGTGTCCTCACATGGTAGAAGG - Intergenic
1040586873 8:48751979-48752001 CTGTGTCTTCACATGGCAGAGGG - Intergenic
1040623200 8:49113006-49113028 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
1040759024 8:50815185-50815207 CTGTGTCTCCAGCTTGCAGATGG - Intergenic
1040984555 8:53279634-53279656 CTGTGTCTTCAGGTGGGGGAAGG - Intergenic
1041159801 8:55027997-55028019 CTGTGTCTTCCAATGGAGGAAGG - Intergenic
1041257623 8:55992785-55992807 CTGTGTCCTCACATGGAAGAAGG + Intronic
1041403904 8:57474850-57474872 CTGTGTCGTCACATGGAATAAGG + Intergenic
1041640872 8:60200130-60200152 CTGTGTCCTCACATGGTAGAAGG - Intronic
1041716933 8:60941015-60941037 CTGTGTTCTCACATGGAAGAAGG + Intergenic
1041860034 8:62502846-62502868 CTTTGTCTTCAGATGGACCAGGG + Intronic
1042076984 8:65007209-65007231 CTGTGTCCTCAGATGGCAGAAGG + Intergenic
1042169553 8:65978341-65978363 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1042236104 8:66614158-66614180 TGGTCTCTCCAGAGGGAAGAAGG - Intronic
1042473164 8:69214166-69214188 CTGTGTCTTCATATAGTAGAAGG - Intergenic
1042936653 8:74066196-74066218 CTGTGTCCTCATATGGCAGAAGG + Intergenic
1043134814 8:76507982-76508004 CTGTGTCTTCACATGGTAGAAGG + Intergenic
1043138561 8:76558602-76558624 ATGTGTCTTCACATGGCAGAGGG - Intergenic
1043322431 8:79006125-79006147 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1043360647 8:79467793-79467815 CTATGTCTCCAGCTTGCAGATGG + Intergenic
1043604016 8:81977356-81977378 CTGTGTCCTCACATGGCAGAGGG - Intergenic
1043676251 8:82958314-82958336 CTGGTTCTCCAGTTTGAAGATGG + Intergenic
1044348157 8:91130879-91130901 CTGTGTCCTCACATGGTAGAAGG + Intronic
1044510639 8:93074351-93074373 CTGTGTCCTCACATGGTAGAGGG - Intergenic
1044725674 8:95192450-95192472 CTGTGTCCCAACATGGTAGAAGG - Intergenic
1044760404 8:95511629-95511651 CTGTGTCACCTCATGGCAGAAGG - Intergenic
1044888213 8:96803057-96803079 CTGGGTCTCCATCTGGTAGATGG - Intronic
1044921024 8:97169643-97169665 CTGTGTCTTCACATAGCAGATGG + Intergenic
1045683144 8:104683850-104683872 CTGTGTCCTCACATGGCAGAAGG + Intronic
1046035810 8:108840141-108840163 CTGGGTCTCCAGCTTGGAGATGG - Intergenic
1046152126 8:110241038-110241060 CTGTGTCCTCATATGGTAGAAGG + Intergenic
1046416640 8:113923678-113923700 CTGTATCTTCACATGGTAGAAGG - Intergenic
1046526941 8:115392742-115392764 CTGTGTCTCATTTTGGAAGATGG + Intergenic
1046592322 8:116221198-116221220 CTGTGTCCCCATATGGTGGAAGG - Intergenic
1046601670 8:116324430-116324452 CTGTTTCTCCAAATGGAAAATGG - Intergenic
1046637226 8:116683388-116683410 CTGTGTCCTCAGGTGGCAGAAGG + Intronic
1047148855 8:122237962-122237984 CTCTGTCTTCATATGGCAGAAGG + Intergenic
1047252866 8:123193772-123193794 CTGTGTCCTCACATGGCAGAAGG + Intronic
1047670198 8:127137536-127137558 CTGTGTCCCCATATGCAAAATGG + Intergenic
1047721162 8:127641006-127641028 CTGTCTCCCCAGATGGAGCATGG - Intergenic
1047874160 8:129116709-129116731 CTGGGTCTCTAAATGGAAGATGG + Intergenic
1048142817 8:131811289-131811311 CTGTGTCCTCACATGGTAGAAGG - Intergenic
1048367076 8:133747376-133747398 CTGTGTTTTCATATGGCAGAAGG - Intergenic
1049671318 8:143871313-143871335 TTGTGCCTCCAGAAGGATGAGGG + Exonic
1050103936 9:2146187-2146209 CTGTGTCCTCACATGGTAGAAGG + Intronic
1050225983 9:3456044-3456066 CTGTGTCCTCACATGGCAGAAGG + Intronic
1050662418 9:7897220-7897242 CTGTGTCTCTACATTGGAGAAGG + Intergenic
1050990952 9:12151303-12151325 CTTTTTCTTCACATGGAAGAAGG + Intergenic
1051114918 9:13683712-13683734 CTGTGTCGTCACATGGCAGAAGG + Intergenic
1051475795 9:17507823-17507845 CTGTGTCTGCTGAAGAAAGAAGG - Intergenic
1051662684 9:19440501-19440523 CTGTGTCCTCACATGGTAGAAGG - Intronic
1051873522 9:21766833-21766855 CTGTGTCACCTCATGGCAGAAGG + Intergenic
1051890977 9:21942607-21942629 CTGTGTCCCCACATAGCAGAAGG - Intronic
1051964846 9:22815314-22815336 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1052024435 9:23558871-23558893 CTGTGTCCCCACATGGTAAAAGG - Intergenic
1052782268 9:32793762-32793784 CTATGTCTTCACATGGCAGAAGG - Intergenic
1052785102 9:32820857-32820879 CTAAGGCTCCAGATGAAAGAAGG - Intergenic
1053044248 9:34900837-34900859 CTGTGTCCTCACATGGAAGAAGG - Intergenic
1053130767 9:35614039-35614061 CTGTATGGCCAAATGGAAGAGGG + Intronic
1053306363 9:36986947-36986969 CTGGGTGTCCAGAGGGAGGAAGG + Intronic
1053793209 9:41701444-41701466 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1053801662 9:41767722-41767744 CTGTGTCATCACATGGCAGAAGG - Intergenic
1054143542 9:61547104-61547126 CTGTGTCATCACATGGCAGAAGG + Intergenic
1054151968 9:61613395-61613417 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1054181618 9:61913456-61913478 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1054190094 9:61979876-61979898 CTGTGTCATCACATGGCAGAAGG - Intergenic
1054463315 9:65478439-65478461 CTGTGTCATCACATGGCAGAAGG + Intergenic
1054471740 9:65544525-65544547 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1054648421 9:67608715-67608737 CTGTGTCATCACATGGCAGAAGG + Intergenic
1054751119 9:68907256-68907278 CTGTGTGTCCACATGGGACAAGG - Intronic
1054877575 9:70112700-70112722 CTGTGTCTCCATATGTGAAATGG - Intronic
1055223095 9:73962735-73962757 CTGGGTCTCCAGATGGCAGATGG - Intergenic
1055411385 9:76033770-76033792 CTGTGTCCTCACATGGTAGAAGG + Intronic
1055663912 9:78534329-78534351 CTGTCTCTTCACATGGTAGAAGG - Intergenic
1055669537 9:78588955-78588977 CTGTGTCATCACATGGCAGAAGG - Intergenic
1055723749 9:79204908-79204930 CTGTGTCCTCACATGGTAGAAGG - Intergenic
1055753884 9:79536316-79536338 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1056009918 9:82317173-82317195 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
1056100283 9:83294196-83294218 CTGTGTCCTCACATGGCAGAAGG - Intronic
1056135200 9:83623639-83623661 CTGTGTGTCCAGATGGCCAAAGG - Intronic
1056315057 9:85380370-85380392 CTGTGTCTGCACATGGATGGAGG + Intergenic
1056423472 9:86453167-86453189 CTGTGTCCTCACATGGTAGAAGG + Intergenic
1056735176 9:89203312-89203334 CTGTGTCTTCACATGGAGGAAGG + Intergenic
1056794070 9:89644969-89644991 CTGTGTCTTCACATGGTAGAGGG - Intergenic
1056872217 9:90292414-90292436 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
1057035106 9:91806317-91806339 CTGTGTCCTCACATGGCAGAAGG + Intronic
1057498659 9:95579672-95579694 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
1057707037 9:97402275-97402297 CTGTGTCCTCAGATGGCAGAAGG + Intergenic
1057871094 9:98718383-98718405 CTGTGTCCTCACATGGTAGAAGG + Intergenic
1058145263 9:101403668-101403690 CTGTGTCTTCACATGGCAGAAGG + Intronic
1058188428 9:101883903-101883925 CTGTGTCCTCAAATGGTAGAAGG - Intergenic
1058560844 9:106227269-106227291 CTGTGTCCTCAGATGGTGGAAGG - Intergenic
1058600093 9:106659884-106659906 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1058743637 9:107968446-107968468 CTGTGTGTCCAGTTGGAGGGAGG + Intergenic
1059543179 9:115150964-115150986 CAGTGTCTCTATATGGAATAAGG - Intronic
1059599643 9:115762872-115762894 CTGTGTCCTCACATGGTAGAAGG + Intergenic
1059808986 9:117835218-117835240 CTGTGTCTTCACATGGTAGAAGG + Intergenic
1059881594 9:118696420-118696442 CTGTGTCCTCAAATGGCAGAGGG + Intergenic
1060046252 9:120343625-120343647 CTGGCTCTGAAGATGGAAGAAGG - Intergenic
1060213224 9:121723160-121723182 CTGTGGCTCTGGAAGGAAGAGGG + Intronic
1060235758 9:121861616-121861638 CTTAGTCTCCAGAAGGAGGAGGG + Intronic
1061084032 9:128389048-128389070 CTTTGTAGCCAGATGGAAAATGG - Intronic
1061089339 9:128418161-128418183 CTGTGTCTTCATGTGGCAGAAGG + Intronic
1061254006 9:129443201-129443223 CTGTGCCCCCAGCTGGGAGAAGG + Intergenic
1061272709 9:129552564-129552586 CTGTGTCCTCACATGGAGGAAGG + Intergenic
1061432755 9:130541721-130541743 CAGTTTCTCCAGCTGTAAGATGG + Intergenic
1185845321 X:3432496-3432518 CTGTGTCCCCACATGGTGGAAGG + Intergenic
1185848411 X:3462382-3462404 CTGTGTCTTCAAATGGTGGAAGG + Intergenic
1185938513 X:4286008-4286030 CTGTGTCCTCACATGGAGGAAGG - Intergenic
1185949823 X:4420665-4420687 CTGTGTCCTCACATGGTAGAAGG - Intergenic
1186083698 X:5962785-5962807 CTGTGTCCTCACATGGAAAAAGG - Intronic
1186117392 X:6319258-6319280 CTGTGTCTACACATGGTGGAAGG + Intergenic
1186140193 X:6563816-6563838 CTGAGTCTCCAGCTTGCAGATGG - Intergenic
1186211400 X:7253979-7254001 CTGTGTCTTCACATGGTGGAAGG + Intronic
1186242354 X:7583141-7583163 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1186276998 X:7949858-7949880 CTGTGTCCTCACATGGTAGATGG + Intergenic
1186313899 X:8348524-8348546 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1186387188 X:9121759-9121781 CTGTGTCTTCACATGGAGGAAGG - Intronic
1186451783 X:9680061-9680083 CTGTGTCTTCACATGGTGGAAGG + Intronic
1186462188 X:9757243-9757265 CTGTGTCCCCACATGGTAGAAGG + Intronic
1186562017 X:10622586-10622608 CTGTGTCCTCACATGGCAGAAGG - Intronic
1186651976 X:11570981-11571003 CTGTGTCCTCACATGGCAGAAGG - Intronic
1186750449 X:12616265-12616287 CTGTGTCTTTACATGGGAGAAGG - Intronic
1186906619 X:14117951-14117973 CTTGGTCTCCACATGGAGGATGG - Intergenic
1187060169 X:15779107-15779129 CTGGGTCTCCAGCTTGCAGATGG - Intronic
1187071644 X:15894214-15894236 CTGTGTCTTCATATGGGGGAAGG + Intergenic
1187316712 X:18202522-18202544 CTGTGTCCTCACATGGCAGAAGG - Intronic
1187440508 X:19313758-19313780 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1187499996 X:19831826-19831848 ATGTGTCCCCAGATGGAATTGGG - Intronic
1187609375 X:20924602-20924624 CTGTGTCCTCATATGGCAGAAGG - Intergenic
1187614589 X:20979661-20979683 CTGTGTCTTCACATGGCAAAAGG + Intergenic
1187685317 X:21810269-21810291 CTGTGTCTCCCCATGGCAGAAGG + Intergenic
1188026768 X:25218092-25218114 CTGTGTCTTCAGCTTGCAGATGG + Intergenic
1188180104 X:27044812-27044834 CTGTGTCTCCAGATTCAAGGGGG + Intergenic
1188760835 X:34027377-34027399 CTGTGTCTACACATGGTGGATGG - Intergenic
1188840759 X:35014153-35014175 CTGTGCCTGCACATGGTAGAAGG - Intergenic
1189215518 X:39319767-39319789 CTTTGGCTCCAGATGGAGGGTGG + Intergenic
1189219949 X:39363014-39363036 CTGTGTCTTCACATGGTGGAAGG - Intergenic
1189274492 X:39775501-39775523 CTGTGTCCTCACATGGTAGAAGG - Intergenic
1189394928 X:40612899-40612921 CTGTGTCGTCACATGGCAGAAGG + Intergenic
1189560234 X:42184763-42184785 CTGTGTCCTCAGATGGTGGAAGG - Intergenic
1189567791 X:42261332-42261354 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
1189569759 X:42283940-42283962 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1189665788 X:43353366-43353388 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
1189916161 X:45857742-45857764 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1190623676 X:52314704-52314726 CTGTGTCCTCACATGGTAGAAGG + Intergenic
1191789166 X:64950735-64950757 GTGTGTCTCCACATGTGAGATGG + Intronic
1192348029 X:70328329-70328351 GTGTGTCCCCACATGGCAGAAGG + Intronic
1192743928 X:73920001-73920023 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
1193500888 X:82273782-82273804 CTGTGTCTTCACATGTCAGAAGG - Intergenic
1193698095 X:84734320-84734342 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1193903418 X:87212763-87212785 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1194047374 X:89024845-89024867 CTGTGTCTTCACATGGCAAAAGG + Intergenic
1194083927 X:89502633-89502655 CTGTGTCCCCAAAGGGAAGAAGG - Intergenic
1194167309 X:90534109-90534131 CTGATTCTCCAGCTTGAAGATGG - Intergenic
1194249977 X:91562729-91562751 CTGTGTCTCTGGGTGGAAGAGGG + Intergenic
1194567941 X:95517026-95517048 CTTTGTTTCCAGATGGAGAAGGG + Intergenic
1194752276 X:97698244-97698266 CTGTGTCTTCACGTGGCAGAAGG + Intergenic
1194752319 X:97698732-97698754 CTGTGTCTTCACATAGCAGAAGG - Intergenic
1194764391 X:97832533-97832555 CTGTGACTTCACATGGCAGAAGG + Intergenic
1194827747 X:98583437-98583459 ATGTGTCTCCACATGGCGGAAGG - Intergenic
1194979097 X:100422489-100422511 CTGTGTATTCACATGGTAGAAGG - Intergenic
1195050662 X:101093873-101093895 CTGTGTCCTCACATGGCAGAAGG + Intronic
1195596272 X:106693781-106693803 CTGTGTGTACAGCTGGAGGAGGG + Intronic
1195696429 X:107671038-107671060 CTGTGTCTCCATCTGTAAAATGG - Intergenic
1196286462 X:113886707-113886729 CTGTGTCCTCACATGGAAGAAGG + Intergenic
1196327158 X:114420035-114420057 CTGTGTCCTCACATGGTAGAAGG - Intergenic
1196422315 X:115535723-115535745 CTGTCTCTCTAATTGGAAGAGGG + Intergenic
1196577203 X:117333157-117333179 CTGTGTCTTCACATGGTAAAAGG - Intergenic
1196731560 X:118946085-118946107 CTGTGTCCTCACATGGTAGAAGG - Intergenic
1196894656 X:120323010-120323032 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
1196974854 X:121148130-121148152 ATGTGTCCTCACATGGAAGAAGG - Intergenic
1196978071 X:121181914-121181936 ATTTGTATCCAGCTGGAAGAAGG + Intergenic
1197405760 X:126047068-126047090 CTGTGTCTTCACATGGTGGAAGG - Intergenic
1197645617 X:129013260-129013282 CTGTGTCTTCGCATGGCAGAAGG - Intergenic
1197712966 X:129685392-129685414 CTGTGTCTTCACATGGCAGAAGG + Intergenic
1197788425 X:130224228-130224250 CTGTGTCTTCACATGGGGGAAGG - Intronic
1197908662 X:131455623-131455645 CTGTGTCTTTACATGGCAGAAGG - Intergenic
1198546442 X:137697449-137697471 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1198885736 X:141334109-141334131 ATGTGGCTTCAGATGGAAGTGGG + Intergenic
1198911825 X:141623511-141623533 CTGTGTCTTCACATGGAAGGTGG - Intronic
1199044942 X:143158877-143158899 CTGTGTCTTAGCATGGAAGAAGG + Intergenic
1199209944 X:145196044-145196066 CTGAGTCTCCAGCTTGCAGATGG + Intergenic
1199234977 X:145481226-145481248 CTGTGTCCCCACATGGCAGAAGG + Intergenic
1199370776 X:147044877-147044899 CTGTGTCTTCACATGGCAGAAGG + Intergenic
1199549611 X:149044356-149044378 CTGTGTCTCCTGAGGGAAGGAGG + Intergenic
1199572316 X:149279275-149279297 CTGGGTCTCCAGCTTGTAGATGG + Intergenic
1199575133 X:149306634-149306656 CTGTGTCACCAGAGGGCACATGG + Intergenic
1199736064 X:150687766-150687788 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1199948999 X:152690618-152690640 GTGTGTCTGCACATGGCAGAAGG + Intergenic
1199949427 X:152695647-152695669 CTATGTCCTCACATGGAAGAAGG - Intergenic
1199960249 X:152772802-152772824 CTATGTCCTCACATGGAAGAAGG + Intergenic
1199960677 X:152777831-152777853 GTGTGTCTGCACATGGCAGAAGG - Intergenic
1200436574 Y:3158513-3158535 CTGTGTCCCCAAAGGGAAGAAGG - Intergenic
1200513573 Y:4111884-4111906 CTGATTCTCCAGCTTGAAGATGG - Intergenic
1200568940 Y:4803978-4804000 CTGTGTCTCTGGGTGGAAGAGGG + Intergenic
1200737044 Y:6811240-6811262 CTGTGTATCCACATGGTAAACGG + Intergenic
1200783488 Y:7238050-7238072 CTGTGTCTTCACATGGTGGAAGG - Intergenic
1200815214 Y:7524423-7524445 CTGTGTCTTCAAATGGTAGAAGG - Intergenic
1201225074 Y:11810788-11810810 TTGTATCTGCAGATGGAGGAAGG - Intergenic
1201446690 Y:14064607-14064629 CTGTGTCCTCACATGGTAGAAGG - Intergenic
1201502700 Y:14662554-14662576 CTGTGTCCTCACATGGTAGAAGG + Intronic
1201511153 Y:14764698-14764720 CTGTGTCCCCACATGGGAAAAGG + Intronic
1201676102 Y:16586110-16586132 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1201688193 Y:16731433-16731455 CTGTGTCCTCACATGGTAGAAGG + Intergenic
1201912878 Y:19151352-19151374 CTGTGACTTCACATGGTAGAAGG + Intergenic
1202036749 Y:20644189-20644211 TTTTCTCTCCAGGTGGAAGACGG + Intergenic