ID: 935712914

View in Genome Browser
Species Human (GRCh38)
Location 2:105914952-105914974
Sequence TAGTAGACACTGCTGGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935712914_935712919 -1 Left 935712914 2:105914952-105914974 CCCAGCCCCAGCAGTGTCTACTA No data
Right 935712919 2:105914974-105914996 ACTTAGTCTAGTTTATCCACAGG No data
935712914_935712922 20 Left 935712914 2:105914952-105914974 CCCAGCCCCAGCAGTGTCTACTA No data
Right 935712922 2:105914995-105915017 GGTGCCCAAGGCACTGTGTGTGG No data
935712914_935712926 29 Left 935712914 2:105914952-105914974 CCCAGCCCCAGCAGTGTCTACTA No data
Right 935712926 2:105915004-105915026 GGCACTGTGTGTGGAACACAGGG No data
935712914_935712920 8 Left 935712914 2:105914952-105914974 CCCAGCCCCAGCAGTGTCTACTA No data
Right 935712920 2:105914983-105915005 AGTTTATCCACAGGTGCCCAAGG No data
935712914_935712925 28 Left 935712914 2:105914952-105914974 CCCAGCCCCAGCAGTGTCTACTA No data
Right 935712925 2:105915003-105915025 AGGCACTGTGTGTGGAACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935712914 Original CRISPR TAGTAGACACTGCTGGGGCT GGG (reversed) Intergenic
No off target data available for this crispr