ID: 935713608

View in Genome Browser
Species Human (GRCh38)
Location 2:105920000-105920022
Sequence GAAATTATGCAGAGGAGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935713600_935713608 17 Left 935713600 2:105919960-105919982 CCAGGAGCAAATGCAATAACACA No data
Right 935713608 2:105920000-105920022 GAAATTATGCAGAGGAGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935713608 Original CRISPR GAAATTATGCAGAGGAGGGA TGG Intergenic
No off target data available for this crispr