ID: 935717995

View in Genome Browser
Species Human (GRCh38)
Location 2:105955357-105955379
Sequence CCTCCTGTGCTGTGGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935717995_935718002 -5 Left 935717995 2:105955357-105955379 CCTTCCACCCACAGCACAGGAGG No data
Right 935718002 2:105955375-105955397 GGAGGCCCCCGGGAGTGACATGG No data
935717995_935718003 -4 Left 935717995 2:105955357-105955379 CCTTCCACCCACAGCACAGGAGG No data
Right 935718003 2:105955376-105955398 GAGGCCCCCGGGAGTGACATGGG No data
935717995_935718010 27 Left 935717995 2:105955357-105955379 CCTTCCACCCACAGCACAGGAGG No data
Right 935718010 2:105955407-105955429 TCAGCTCCCTCTCTGCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935717995 Original CRISPR CCTCCTGTGCTGTGGGTGGA AGG (reversed) Intergenic
No off target data available for this crispr