ID: 935720728

View in Genome Browser
Species Human (GRCh38)
Location 2:105976673-105976695
Sequence CACACAGTTGTGCCACTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935720727_935720728 3 Left 935720727 2:105976647-105976669 CCGTCTCAAAAAAAAAAAAAAAA 0: 83672
1: 60776
2: 74199
3: 114646
4: 163091
Right 935720728 2:105976673-105976695 CACACAGTTGTGCCACTGTCAGG No data
935720726_935720728 23 Left 935720726 2:105976627-105976649 CCTGGCAACAGAGTGAGACTCCG 0: 405
1: 2598
2: 6904
3: 12864
4: 15749
Right 935720728 2:105976673-105976695 CACACAGTTGTGCCACTGTCAGG No data
935720725_935720728 27 Left 935720725 2:105976623-105976645 CCAGCCTGGCAACAGAGTGAGAC 0: 1383
1: 4270
2: 9309
3: 12054
4: 12364
Right 935720728 2:105976673-105976695 CACACAGTTGTGCCACTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935720728 Original CRISPR CACACAGTTGTGCCACTGTC AGG Intergenic
No off target data available for this crispr