ID: 935722571

View in Genome Browser
Species Human (GRCh38)
Location 2:105992442-105992464
Sequence GCTGGTGGTACTCACCATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935722567_935722571 -8 Left 935722567 2:105992427-105992449 CCTGATGGTGGCCATGCTGGTGG No data
Right 935722571 2:105992442-105992464 GCTGGTGGTACTCACCATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935722571 Original CRISPR GCTGGTGGTACTCACCATGG TGG Intergenic
No off target data available for this crispr