ID: 935723524

View in Genome Browser
Species Human (GRCh38)
Location 2:106000586-106000608
Sequence GAGTGGGACCGGAGGGAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935723524_935723532 4 Left 935723524 2:106000586-106000608 CCTACCTCCCTCCGGTCCCACTC No data
Right 935723532 2:106000613-106000635 CCCCTTCTTTCCCCAGCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935723524 Original CRISPR GAGTGGGACCGGAGGGAGGT AGG (reversed) Intergenic
No off target data available for this crispr