ID: 935724479

View in Genome Browser
Species Human (GRCh38)
Location 2:106011080-106011102
Sequence TGGGATTTATTGGGAAAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935724479_935724487 21 Left 935724479 2:106011080-106011102 CCCTTTTTTCCCAATAAATCCCA No data
Right 935724487 2:106011124-106011146 TCCACGAGCCTAATTTTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935724479 Original CRISPR TGGGATTTATTGGGAAAAAA GGG (reversed) Intergenic
No off target data available for this crispr