ID: 935724480

View in Genome Browser
Species Human (GRCh38)
Location 2:106011081-106011103
Sequence ATGGGATTTATTGGGAAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935724480_935724487 20 Left 935724480 2:106011081-106011103 CCTTTTTTCCCAATAAATCCCAT No data
Right 935724487 2:106011124-106011146 TCCACGAGCCTAATTTTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935724480 Original CRISPR ATGGGATTTATTGGGAAAAA AGG (reversed) Intergenic
No off target data available for this crispr