ID: 935724481

View in Genome Browser
Species Human (GRCh38)
Location 2:106011089-106011111
Sequence TGAGAAAAATGGGATTTATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935724481_935724487 12 Left 935724481 2:106011089-106011111 CCCAATAAATCCCATTTTTCTCA No data
Right 935724487 2:106011124-106011146 TCCACGAGCCTAATTTTTCATGG No data
935724481_935724490 25 Left 935724481 2:106011089-106011111 CCCAATAAATCCCATTTTTCTCA No data
Right 935724490 2:106011137-106011159 TTTTTCATGGTCATGTGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935724481 Original CRISPR TGAGAAAAATGGGATTTATT GGG (reversed) Intergenic
No off target data available for this crispr