ID: 935724482

View in Genome Browser
Species Human (GRCh38)
Location 2:106011090-106011112
Sequence GTGAGAAAAATGGGATTTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 751
Summary {0: 10, 1: 67, 2: 63, 3: 124, 4: 487}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935724482_935724487 11 Left 935724482 2:106011090-106011112 CCAATAAATCCCATTTTTCTCAC 0: 10
1: 67
2: 63
3: 124
4: 487
Right 935724487 2:106011124-106011146 TCCACGAGCCTAATTTTTCATGG No data
935724482_935724490 24 Left 935724482 2:106011090-106011112 CCAATAAATCCCATTTTTCTCAC 0: 10
1: 67
2: 63
3: 124
4: 487
Right 935724490 2:106011137-106011159 TTTTTCATGGTCATGTGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935724482 Original CRISPR GTGAGAAAAATGGGATTTAT TGG (reversed) Intergenic
900727661 1:4228377-4228399 GTGAGAAAAATGGAATTTATTGG - Intergenic
900754554 1:4424657-4424679 CTGAGAATAATAGGATTTATTGG - Intergenic
900891267 1:5451362-5451384 GTGAGAAACATGGAATGTACTGG - Intergenic
901481407 1:9527797-9527819 GTGAGAAAAATGAAATTTACTGG + Intergenic
902789173 1:18753782-18753804 GAGAGAAATATGGGACTTAGGGG + Intergenic
903122034 1:21222478-21222500 GTGAGCACATTGGGATTTGTGGG + Intronic
904006521 1:27366082-27366104 GTGAAAAAAGTGGGATTTAGGGG - Intronic
904734796 1:32623364-32623386 GAGTGAAAAAGGGAATTTATTGG - Intronic
906750076 1:48250932-48250954 GTGAGAATAATGGGATTTATTGG - Intergenic
906766486 1:48439182-48439204 CCGAGAAAAATTGGATTTAGTGG - Intronic
907842173 1:58168907-58168929 CCGAGAAAAATCGGATTTAGTGG - Intronic
908300260 1:62755741-62755763 CTGAGAAAAATCAGATTTAGTGG - Intergenic
909084255 1:71153071-71153093 GTGAGAAAACTAAGAGTTATTGG - Intergenic
909199325 1:72669784-72669806 GTGAGAAAAATGGAATTTATTGG + Intergenic
909681540 1:78297436-78297458 GTGAGAAAAATGAGTCTTAAAGG - Intergenic
910151436 1:84151914-84151936 GTAAGAACATTGTGATTTATGGG - Intronic
910273040 1:85417760-85417782 ATGAGAGAAATGGCTTTTATAGG - Intronic
910397667 1:86808292-86808314 CTGAGAAAAATCAGATTTAGTGG + Intergenic
910564664 1:88630245-88630267 GTGAGAAACAAGGAATTTATGGG - Intergenic
910626413 1:89312859-89312881 GTGAGGAAAACAGAATTTATTGG + Intergenic
910913664 1:92265357-92265379 AAGAAAAAAAGGGGATTTATTGG + Intronic
911265063 1:95733747-95733769 GTGGGAAAAATGGAATTTATTGG + Intergenic
911298808 1:96149309-96149331 CTGAGAAAAATCGTATTTAGTGG - Intergenic
911407117 1:97455839-97455861 AAGAGAAAAATATGATTTATTGG - Intronic
911648149 1:100357233-100357255 GTGAGAATGATGCGATTTCTGGG + Intronic
912021140 1:105110504-105110526 CTGAGAAAAATCGGATTTAGAGG - Intergenic
912105912 1:106275013-106275035 ATGAGAAAACTGAGATTTAGTGG - Intergenic
912133931 1:106636495-106636517 GTGAGAAAAATAAGATTTACTGG + Intergenic
912201524 1:107463301-107463323 GTGAGAATAATGGGAAAGATTGG - Intronic
913103643 1:115592902-115592924 GTGAGGAAAATGGAATTTATAGG - Intergenic
913303965 1:117404415-117404437 GTGATACAAATAGTATTTATTGG + Intronic
913469338 1:119173700-119173722 CCGAGAAAAATCGGATTTAGTGG - Intergenic
914927916 1:151905313-151905335 GTGAGAATAATGGAATTTATTGG - Intronic
914948421 1:152087605-152087627 GTCAGAAAAATAGGATTCTTGGG - Intronic
915260408 1:154672965-154672987 CTGAGAAAAATCGGATTTAGTGG - Intergenic
915998301 1:160588001-160588023 GTGAAAGAATTGGGATTCATTGG + Intergenic
916419966 1:164627836-164627858 GTGAGAAAAATGAGATTATCTGG - Intronic
916918326 1:169435468-169435490 GTAAGAAAAATGGGTTTTCCAGG + Intronic
917085984 1:171306335-171306357 CTGAGAAAAATTGGATTTAGTGG - Intergenic
917209424 1:172616400-172616422 TTGAGAAAAATGGAATTTATTGG - Intergenic
917210085 1:172622224-172622246 GTGAGAAAAATGGAATTTATTGG - Intergenic
917445973 1:175106120-175106142 CTGAGAAAAATCAGATTTAGTGG + Intronic
917556514 1:176096057-176096079 ATGAGGAAAGTGGAATTTATTGG - Intronic
917557223 1:176102276-176102298 GTGAGGAAAACGTAATTTATTGG - Intronic
918750319 1:188262250-188262272 CTGAGAAAAATCGGATTTAGTGG + Intergenic
918889517 1:190247634-190247656 GTGAGAAGTATGGGAAATATAGG - Intronic
921019544 1:211223664-211223686 TCGAGAAAAATTGGATTTAGTGG - Intergenic
921305023 1:213787647-213787669 ATAAGGAAGATGGGATTTATTGG + Intergenic
921433318 1:215087615-215087637 GTAAGAAAAGTGGGCTCTATAGG - Intronic
922002537 1:221494669-221494691 GTGAATAGAATGGGATTTATTGG + Intergenic
922339422 1:224643665-224643687 GTGAGAATAATGGGATTTATTGG + Intronic
922990660 1:229908245-229908267 GTGAGAAAAATGAGAATGAGGGG - Intergenic
923015963 1:230126895-230126917 GTGAGGAGAAAAGGATTTATGGG + Intronic
923110404 1:230885465-230885487 GTGAGAAAAATGGAATGGAGGGG - Intergenic
923973947 1:239238281-239238303 GTGAGAAAAATGGAATTTATTGG - Intergenic
1063030067 10:2225634-2225656 GTCAGAATAATGAGATTTATTGG + Intergenic
1063321872 10:5058841-5058863 CTGAGAAAAATCAGATTTAGTGG + Intronic
1064560791 10:16593808-16593830 GTGATAAAAATGGGATTGAATGG + Intronic
1064707824 10:18091057-18091079 CTTAGAAAAATGGGATTATTTGG + Intergenic
1064790800 10:18955966-18955988 GTGAGAAAAATTGGCTCTGTGGG - Intergenic
1064863708 10:19854883-19854905 GCGAGAAAAATGTGTTATATTGG + Intronic
1065643821 10:27814118-27814140 GGGAGAAAAATGGAATTTATTGG + Intronic
1066611028 10:37248655-37248677 GTGAGTAAAATTGGCTATATAGG + Intronic
1067711399 10:48654091-48654113 GTTAAAAAGAGGGGATTTATTGG + Intronic
1067725616 10:48768472-48768494 GTGAGGAAAATGGGCTTTCGGGG - Intronic
1067911293 10:50349581-50349603 ATGAGGAGAATGGGAATTATGGG - Intronic
1068144643 10:53052080-53052102 GTATGAAGAATGAGATTTATGGG + Intergenic
1068217130 10:53996859-53996881 GTGAGAAAAAGGGGACTTGGAGG - Intronic
1068377138 10:56195510-56195532 GTGAGTAGAGTGGGATTTATTGG - Intergenic
1068500155 10:57834082-57834104 CTGAGAAAAATCGGATTTAGTGG - Intergenic
1068845883 10:61673228-61673250 GTGAATACAATGGAATTTATAGG + Intronic
1071034962 10:81233764-81233786 GTGGGGATAATGGGAATTATGGG - Intergenic
1072550554 10:96474128-96474150 GTGAGAAGAATGGGAGTCCTGGG - Intronic
1072752251 10:97989999-97990021 GTCATAAAAATGGGATTAAAAGG - Intronic
1073970601 10:109042672-109042694 CTGAGAAAAATCAGATTTAGTGG - Intergenic
1074612867 10:115038440-115038462 CCGAGAAAAATCGGATTTAGTGG - Intergenic
1074665177 10:115714300-115714322 GTGGGAAAAATTGAATTTATTGG + Intronic
1075443840 10:122500294-122500316 GTATGAAAAAGGGGATTTATTGG + Intronic
1075586246 10:123660366-123660388 GAGAGAAGAATGGGAGTGATGGG + Intergenic
1076047507 10:127306375-127306397 GTGAGAACACTGGGCTTTTTAGG + Intronic
1076236347 10:128866307-128866329 GTGAAAACAATTGGAGTTATGGG + Intergenic
1076724274 10:132406170-132406192 GTAAGAAGAAGGGGATGTATCGG + Exonic
1077113552 11:872756-872778 GTGAGAAGAATGGGATGTGCAGG + Intronic
1078424209 11:11236004-11236026 ATGTCAAAAATGGGCTTTATTGG - Intergenic
1078492694 11:11784201-11784223 GTGATAACAATGGTACTTATAGG - Intergenic
1078535795 11:12172656-12172678 GTGAGAAAAATGGAATGTATTGG + Intronic
1078656908 11:13249731-13249753 ATTTGAAAAATGGGTTTTATAGG + Intergenic
1078680940 11:13475136-13475158 GTGAGAATAGTGGAATTCATTGG + Intergenic
1078736984 11:14029483-14029505 GTGAGGAAAACAGAATTTATTGG + Intronic
1079487287 11:20948566-20948588 GTTAGATAAAAGGAATTTATTGG - Intronic
1079731388 11:23940193-23940215 CCGAGAAAAATCGGATTTAGTGG + Intergenic
1079749116 11:24173585-24173607 GTGAGGAAAATTGAATTTACTGG + Intergenic
1079807565 11:24953525-24953547 GTCAGAAAAAGGAGATTTAGAGG + Intronic
1080003005 11:27372163-27372185 GTGAGAAAAATGGCATTGTCTGG - Intronic
1080452270 11:32388067-32388089 GTGAAAAAAATGAGACTTACTGG - Exonic
1080772099 11:35351164-35351186 GTGAGAAAATTGAGGTTTAGAGG + Intronic
1080963028 11:37182055-37182077 GTGAGGAAAATGGAATTTATTGG - Intergenic
1081011646 11:37820543-37820565 GTGAGAATAATGGGATTTATTGG + Intergenic
1081033271 11:38112882-38112904 CCGAGAAAAATTGGATTTAGTGG - Intergenic
1081115919 11:39200147-39200169 GTGAGAAAAATGACATTAAAAGG + Intergenic
1081154775 11:39676912-39676934 GTGAGAAAAATTGAATTTATTGG + Intergenic
1081421262 11:42876361-42876383 CCGAGAAAAATTGGATTTAGTGG - Intergenic
1082633336 11:55566565-55566587 GTGAGAAAAATGGAATTTATTGG + Intergenic
1082659812 11:55895746-55895768 GTGAGAATAACAGGATTTATTGG - Intergenic
1082888958 11:58118116-58118138 GAGATAAAAGTGGGATTGATGGG + Intronic
1082906270 11:58311206-58311228 CTGAGAAAAGTCGGATTTAGTGG + Intergenic
1082906282 11:58311295-58311317 CTGAGAAAAATCGGATTTAGTGG + Intergenic
1084210829 11:67621417-67621439 CCGAGAAAAATCGGATTTAGTGG - Intergenic
1084879803 11:72162930-72162952 GTGAGAAAAATGGAATTTATTGG + Intergenic
1086133636 11:83425149-83425171 GTGCAAAAAATGGAATTTATTGG + Intergenic
1086568375 11:88253557-88253579 GTGATAAAAATGGCACTTTTGGG + Intergenic
1087127242 11:94640182-94640204 GTGAGAAAAATGGTATTTATTGG - Intergenic
1087739489 11:101871175-101871197 GTAAGAAAAATGGGAATTTCTGG + Intronic
1088161451 11:106876576-106876598 GTTATGAAAATGGTATTTATAGG - Intronic
1088198568 11:107304450-107304472 GTGAGATAAATGTGAATTGTGGG + Intergenic
1088559348 11:111097179-111097201 GTGAGGAAAACGGAATTTACTGG + Intergenic
1088930233 11:114344036-114344058 GTGAGAAAACTAAGATTTGTTGG + Intergenic
1090487557 11:127127643-127127665 GTGAGAAAAATGGAATTTATTGG + Intergenic
1090985767 11:131764784-131764806 GTGAGGACAAGGTGATTTATAGG - Intronic
1091528177 12:1327544-1327566 GAGAGAAAAAGGGGACTTCTAGG - Intronic
1092720490 12:11435919-11435941 GTGAGAAAAATGGAATTTATTGG + Intronic
1092737022 12:11592486-11592508 GCGAGAAAAATGGAATATATTGG + Intergenic
1093199969 12:16174709-16174731 TAAAGAAAAATGGAATTTATTGG - Intergenic
1093204365 12:16229457-16229479 GTGAAAAAAATGGATGTTATGGG - Intronic
1093580707 12:20781904-20781926 CTGAGGAAAATCGGATTTAGTGG + Intergenic
1093637885 12:21493366-21493388 GTGAGAATAATGGGGTTGACTGG + Intronic
1093691353 12:22113169-22113191 GTGAAGCAAATGGGCTTTATTGG + Intronic
1093922029 12:24869445-24869467 GTGAGAATAATGGAACTTATTGG - Intronic
1093933934 12:24981280-24981302 ATGTCAAAAATGGGTTTTATTGG + Intergenic
1093955640 12:25214892-25214914 GTGAGAAACCTGGGAATTTTAGG - Intronic
1094443657 12:30506728-30506750 GTGAGAAAAATGGAAATTATTGG - Intergenic
1095771102 12:45958203-45958225 GTTAAGTAAATGGGATTTATTGG - Intronic
1096155292 12:49338306-49338328 GTAGGAAAAATGGCATTTGTGGG - Intergenic
1097612226 12:61838334-61838356 TTGGGAAAAGCGGGATTTATTGG - Intronic
1098643883 12:72873319-72873341 GTGAGGAAAATGGAATTTACTGG - Intergenic
1098805970 12:75020434-75020456 GTGAGTAAAGTAGGGTTTATTGG + Intergenic
1099637802 12:85237403-85237425 CTGAGATAAATGGTATTTACAGG + Intronic
1100050904 12:90446899-90446921 CTGAGAAAAATTGGATTTAGTGG + Intergenic
1100052276 12:90462730-90462752 ATAAGAAAAATGGGTTTAATTGG + Intergenic
1100094602 12:91017546-91017568 GAGAGAAAAATGATAGTTATGGG - Intergenic
1100271580 12:93030083-93030105 GTGAGAAAAATGGAATTTATTGG - Intergenic
1100272212 12:93037339-93037361 GTAAGGAAAACGGAATTTATTGG + Intergenic
1100702330 12:97161625-97161647 GTGAGGAAAATAGACTTTATAGG + Intergenic
1100903642 12:99272752-99272774 TAGAGAAGAAAGGGATTTATAGG - Intronic
1101097496 12:101357876-101357898 GTGAGAAATGTAGGATTTAAAGG + Intronic
1101779515 12:107823108-107823130 CTGAGAAAAATCAGATTTATTGG - Intergenic
1101969772 12:109304826-109304848 GGGAGAAAAATGGGAGTGGTTGG + Intronic
1102950126 12:117025839-117025861 GAGAGAAAAATGAGATCTACTGG - Intronic
1103962612 12:124618372-124618394 TTCAGAAAAATGTGATTCATTGG + Intergenic
1104232410 12:126898066-126898088 GTCAGAGGAAGGGGATTTATCGG + Intergenic
1104647937 12:130510216-130510238 GTGGGACAAATAGGATTTAGGGG - Intronic
1104746767 12:131215581-131215603 GTGACAGAAAGGGGATTTATTGG - Intergenic
1105390041 13:19967393-19967415 ATGAGAAAAATGGCTTTTTTTGG - Intronic
1105393850 13:20009553-20009575 TAGAAAAAAATGGGAGTTATTGG - Intronic
1105762324 13:23526230-23526252 CCGAGAAAAATCGGATTTAGTGG - Intergenic
1105773388 13:23634099-23634121 TTGAGAAAAAGGGCATTTCTTGG - Intronic
1105885728 13:24639535-24639557 ATGAGAAAAATGGAATTCATTGG + Intergenic
1106162541 13:27214082-27214104 CTGAGAAAAATCGGATTTAATGG - Intergenic
1106943841 13:34803596-34803618 GTGAGTAGAGTGGGGTTTATTGG + Intergenic
1107103998 13:36624111-36624133 GTGAGAAAAATGGGATTTATTGG - Intergenic
1107852874 13:44588465-44588487 GTAAGAAGAATGGAATTTATTGG - Intergenic
1108000314 13:45900250-45900272 GTGAGAAAAATGGAATTTTTTGG + Intergenic
1108037927 13:46311600-46311622 GTGAGAATAATGGAATTCATTGG + Intergenic
1108425871 13:50299567-50299589 GTGGGAAAGATGGGCTATATTGG - Intronic
1108584522 13:51858711-51858733 GTAAGAAAAACGAAATTTATTGG + Intergenic
1109289802 13:60460014-60460036 GAGGGAGAAGTGGGATTTATGGG + Intronic
1109399777 13:61811093-61811115 GAGAAAAAAATGGTAGTTATGGG - Intergenic
1109500896 13:63235265-63235287 CTGAGAAAAATCAGATTTAGTGG - Intergenic
1109661795 13:65469290-65469312 GTGAGTAAAATGAGACTTAAAGG - Intergenic
1110413329 13:75226503-75226525 GTGAGAAAAGTGGGATTTATTGG - Intergenic
1111068803 13:83135104-83135126 GGAAGAATAATGGGATGTATGGG - Intergenic
1111167915 13:84486889-84486911 GTGGGAAAAATGGGAATGCTGGG - Intergenic
1111372417 13:87335074-87335096 CTGAGAAAAATCGGATTTAGTGG - Intergenic
1111638500 13:90936543-90936565 AAGAGAAAAATATGATTTATAGG - Intergenic
1111727484 13:92030893-92030915 GTGAGTAAAATGGAATTTATTGG - Intronic
1111941226 13:94609938-94609960 GTTGGAAAAATGTTATTTATAGG - Intronic
1112272168 13:97977503-97977525 GTGGGATAAATGGGATGTAGTGG + Intronic
1112518972 13:100079740-100079762 CCGAGAAAAATCGGATTTAGTGG - Intergenic
1112605755 13:100904307-100904329 GTGAGAAAAATGGAATTTATTGG + Intergenic
1113030684 13:105990643-105990665 GTGAGAAAAATGGGATATTTGGG - Intergenic
1113128579 13:107008696-107008718 GTGAGAAAGACGGGAGTGATGGG + Intergenic
1113338726 13:109401610-109401632 GTGAGAAAAATGGAATTTATCGG - Intergenic
1114007056 14:18325190-18325212 GTGAGAAAAATGGAATTTATTGG - Intergenic
1114566589 14:23637649-23637671 CCGAGAAAAATCGGATTTAGTGG - Intronic
1114667763 14:24390318-24390340 GTGAGGAAATTGGGATTTCCAGG + Intergenic
1114855327 14:26432403-26432425 GGCAGAAAAATGGAATATATGGG + Intergenic
1115528424 14:34303797-34303819 GTGAGAAAACTGAGATTCAGAGG + Intronic
1116256393 14:42562065-42562087 GTGAGGGGAATGGAATTTATTGG + Intergenic
1116311216 14:43328429-43328451 GTATGAGAAATGGGTTTTATTGG - Intergenic
1116346297 14:43799149-43799171 GTGAAAAAAATAGCATTTAAAGG + Intergenic
1116384833 14:44317398-44317420 GTAAGAAAAATGATATTTATTGG + Intergenic
1116434936 14:44886371-44886393 TTGAGAAAAAAGAGATTTATTGG - Intergenic
1116762673 14:49033530-49033552 GTGAGAAAAATGAGATATATTGG - Intergenic
1117565868 14:56992665-56992687 GTGAGAAAAATGGAACTTATTGG - Intergenic
1117677224 14:58167090-58167112 GAGAGATAGATGGGATTGATGGG - Intronic
1118091584 14:62486488-62486510 GTGAGAAAAATGAGATTTATGGG - Intergenic
1118377992 14:65193392-65193414 GTGAGAAAAATGGAATTTATTGG + Intergenic
1118395814 14:65335601-65335623 GTGAGAAGAATGGAACTTATTGG + Intergenic
1118678325 14:68212766-68212788 GTGAGAAAAATGTGATTATTAGG + Intronic
1119128756 14:72152868-72152890 GTGAGAAAAATGGAATTTATTGG + Intronic
1119166332 14:72497638-72497660 CTGGGAAGAATGGGATTTAAGGG - Intronic
1120002521 14:79318617-79318639 GCGAGTAATATGGGATTTATTGG + Intronic
1120153547 14:81065044-81065066 GTGACAAAAATAGAATTTATTGG + Intronic
1120591921 14:86385941-86385963 GTGAGAGAACTGGGTGTTATGGG - Intergenic
1121170511 14:91850073-91850095 GTTTAAAAAATGGGATTTAGAGG + Intronic
1121480194 14:94261995-94262017 ATGACAAAAAGGGGAATTATAGG - Intronic
1121486239 14:94317574-94317596 GTGAATAAAATGGAATTTATTGG - Intronic
1121872885 14:97425769-97425791 GTGGGAAAGATGAGAGTTATGGG + Intergenic
1121908639 14:97769475-97769497 GACAGAACAATAGGATTTATGGG + Intergenic
1122723478 14:103735385-103735407 GTGAGAAAAATAGGATATTCTGG - Intronic
1123390972 15:19871834-19871856 GTGAGAAAAATGGAATTTATTGG - Intergenic
1123765834 15:23477703-23477725 GAGAAAAAAATGGAATTTATTGG - Intergenic
1124022557 15:25938018-25938040 GGGAGAAAAATGGTATTTAATGG - Intergenic
1124725345 15:32151682-32151704 GAGAGAAAAATGGAAATTAAAGG - Intronic
1126065715 15:44824838-44824860 GAGAGGCAAATAGGATTTATGGG + Intergenic
1126094120 15:45075729-45075751 GAGAGGCAAATAGGATTTATGGG - Exonic
1126145779 15:45471570-45471592 GTGAGAAAAATGGGATTTATTGG - Intergenic
1127544857 15:59982822-59982844 GTAATAAAAATGGCATGTATTGG + Intergenic
1128338400 15:66803094-66803116 GTGAGAGAGATGGGAATTCTTGG + Intergenic
1128492626 15:68164498-68164520 GTGAGAAATAGGAAATTTATAGG + Intronic
1128999012 15:72318004-72318026 GTGAGAAGAGTGAGATTTAAGGG + Intronic
1129579912 15:76797644-76797666 GTGAGAACTAAGAGATTTATTGG + Intronic
1129969968 15:79769501-79769523 GGGAGAAAAAAGGGATGCATTGG + Intergenic
1130413185 15:83664562-83664584 ATGGGAAAAATGGGAGTTAGTGG - Intronic
1131002201 15:88947984-88948006 GTGAGGGAAGTGGGATATATAGG + Intergenic
1131007618 15:88991287-88991309 GTGAGAAGGGTAGGATTTATTGG + Intergenic
1131411037 15:92208603-92208625 CTGAGAAAAATCAGATTTATTGG - Intergenic
1131817174 15:96233845-96233867 GTTAGAAAAACGGAATTTATTGG - Intergenic
1131824027 15:96302839-96302861 ATGAGAAAAATGGGGCTTAACGG + Intergenic
1132062247 15:98701946-98701968 GTGAGGAAGATGGGGTTTAGAGG + Intronic
1132337160 15:101055325-101055347 GTGAGAAAAATGTGCTTTTGGGG - Intronic
1132387851 15:101413255-101413277 GAGAGAATAATGGGATATAAAGG + Intronic
1133291872 16:4727784-4727806 GTGAGAAAGATGGGATTCTTTGG - Intronic
1133558684 16:6929614-6929636 GTGAGAAAAATTGAATTTGGTGG - Intronic
1133882237 16:9793415-9793437 ATGAGATAGATGGGACTTATGGG + Intronic
1134343598 16:13368274-13368296 GTGAGAAAAGGGGGATTTCAAGG + Intergenic
1135339817 16:21635989-21636011 CTGAGAAAAATTGGATTTAGTGG + Intronic
1135409372 16:22221654-22221676 GTCAAAAAAATTGGAATTATTGG + Intronic
1135953049 16:26933212-26933234 GTGGTAAAACTGGCATTTATAGG - Intergenic
1137683417 16:50369846-50369868 GTAAATAAAAAGGGATTTATTGG + Intergenic
1137855984 16:51795139-51795161 AAGTAAAAAATGGGATTTATTGG - Intergenic
1138174543 16:54884651-54884673 GTGAGAAAAATGGAATTTATTGG - Intergenic
1138572970 16:57887662-57887684 TTGAGAAAAACGGGAATTAGGGG - Intronic
1138627389 16:58263317-58263339 ATGAGAGAAATGGAATTTCTGGG - Intronic
1139180447 16:64741631-64741653 ATGAGAAAAATAAGATCTATAGG + Intergenic
1140933019 16:79645276-79645298 ATGAGGAAAATGGCATTTACAGG - Intergenic
1142868907 17:2808108-2808130 GTGAGAACAACGGGATTTACTGG - Intronic
1144143766 17:12377128-12377150 GTGAGGAAAATGAAATTTATTGG + Intergenic
1144933300 17:18877549-18877571 CTGAGAAAAGAGGAATTTATTGG + Intronic
1145405291 17:22585045-22585067 GTGAGGAAAATGGGATTTATTGG + Intergenic
1146081739 17:29786457-29786479 GTGAGAATAATGGGATTTATGGG - Intronic
1146710454 17:35036525-35036547 GGGAGAAAAATGGGAGATGTAGG + Intronic
1146981893 17:37170715-37170737 GTCAGACTAATGGCATTTATGGG - Intronic
1147314168 17:39611744-39611766 GAGAGAAAAAAGGGAGTGATGGG + Intergenic
1147500054 17:40954450-40954472 GTTTGAAAAATGGAAATTATGGG + Intergenic
1149209511 17:54287611-54287633 CTGAGGAAAATCGGATTTAGTGG - Intergenic
1149213308 17:54327936-54327958 CTGAGAAAAATTGGATTTAGTGG + Intergenic
1149223402 17:54440615-54440637 CTGAGAAAAATTGGATTTAGTGG - Intergenic
1149887625 17:60356377-60356399 GTGAGAGATATGGGAATTTTGGG - Intronic
1150839162 17:68591903-68591925 GTGAGGAAAACGGAATTTACTGG - Intronic
1151567858 17:74909817-74909839 CTGAGAAAAATAGGATTTAGTGG - Intergenic
1153278722 18:3394218-3394240 GTGGGAAAAATGGGAGATATTGG + Intergenic
1154399204 18:14019211-14019233 GTGAGAAATCTGAGATTTCTGGG + Intergenic
1154530413 18:15338817-15338839 GTAAGAAAAATGGAATTTATTGG + Intergenic
1155606855 18:27616061-27616083 GTGGGAAAAATGGAATTTATTGG - Intergenic
1156152536 18:34259773-34259795 GTTAGAAAAAGGACATTTATGGG - Intergenic
1156553035 18:38038556-38038578 GTGAGAAACATGGCAATTAAAGG - Intergenic
1156995282 18:43458171-43458193 GTGGGGATAATGGGAATTATGGG + Intergenic
1157858064 18:51119121-51119143 CCGAGAAAAATCGGATTTAGTGG + Intergenic
1158051141 18:53221543-53221565 GAGAGAAAATGGGGAGTTATTGG + Intronic
1158152420 18:54387674-54387696 GTGAGAATAATGGAATTTATCGG + Intergenic
1158257215 18:55565136-55565158 CTGGGAAGAATGGGAGTTATAGG + Intronic
1158535845 18:58307353-58307375 GTGAGAAAAATGGGATTTATTGG - Intronic
1158732794 18:60043872-60043894 GTGAGGAAAATGGGAGATTTTGG + Intergenic
1158781325 18:60655829-60655851 ATCAAAAAAATGGGATTTCTGGG - Intergenic
1159201037 18:65184418-65184440 ATGAAAGAAATGGGATTAATAGG - Intergenic
1159481979 18:69001461-69001483 GTGAGAAAAATGGGTTTTATTGG + Intronic
1159663290 18:71125991-71126013 GTCAGAAAAATGGCCTTTACTGG + Intergenic
1159881247 18:73860498-73860520 GTGTGTAAAATGGAATTAATTGG - Intergenic
1162107763 19:8380852-8380874 CCGAGAAAAATTGGATTTAGTGG - Intronic
1163356449 19:16814979-16815001 ATGAGAAAAATGGGGTGTAGAGG - Intronic
1164870744 19:31640731-31640753 GAGAGAGAAATGGGATCTAGTGG + Intergenic
1164993117 19:32698792-32698814 CTGAGAAAAATCAGATTTAGTGG + Intronic
1165004366 19:32792604-32792626 TTCTGAAAAATGGGATTTCTAGG + Intronic
1166181486 19:41112344-41112366 TTGGGGAAACTGGGATTTATGGG - Intergenic
1167725037 19:51205694-51205716 GTGAGGAAAATAGGTTTAATTGG - Intergenic
925160665 2:1681329-1681351 GTGAGAAAAATGGGATTTATTGG - Intronic
925758787 2:7163492-7163514 CTGAGAGAACTGGTATTTATTGG - Intergenic
925950064 2:8901405-8901427 CCGAGAAAAATTGGATTTAGTGG + Intronic
926239176 2:11071592-11071614 GTGAGAAAAATGGAATTTATTGG - Intergenic
926620240 2:15040782-15040804 GTGCGAGCACTGGGATTTATGGG - Intergenic
926819085 2:16833269-16833291 GTCAGAAAAATGGAAATAATTGG - Intergenic
926838894 2:17056554-17056576 TTGAGAAAAATGGGATTTATTGG - Intergenic
926888931 2:17622721-17622743 GTGAGGAAAATGGAATTCACTGG + Intronic
927045333 2:19272449-19272471 GAGAAAAACATGGAATTTATTGG - Intergenic
927311554 2:21637497-21637519 GAGGGAAAAATGGGATCCATGGG - Intergenic
927711817 2:25330828-25330850 CTGAGCTAAATGGGAGTTATTGG - Intronic
928240290 2:29580209-29580231 GTGAGATAAATGGGTTTGACTGG - Intronic
928571638 2:32615179-32615201 GTGAGAGAAATGGGGATCATGGG - Intronic
928822265 2:35375581-35375603 TTGAGATAAATGAGAATTATAGG - Intergenic
929974372 2:46617288-46617310 GTGCGAAAAATGTGAGTTAAGGG + Exonic
930038353 2:47101954-47101976 CCGAGAAAAATCGGATTTAGTGG - Intronic
930066757 2:47333543-47333565 GGGAGAAAAAGGGTGTTTATAGG - Intergenic
931101145 2:59002267-59002289 GTGTGTTTAATGGGATTTATGGG + Intergenic
931540326 2:63323705-63323727 CCGAGAAAAATCGGATTTAGTGG - Intronic
931933083 2:67162906-67162928 GTGAGAAAAAGGGACTTAATTGG - Intergenic
933022997 2:77218452-77218474 TTAAGAGAGATGGGATTTATGGG - Intronic
933039609 2:77446745-77446767 GGGAGAAAAATGGCATATCTTGG - Intronic
933210683 2:79565219-79565241 GTGAGAAAAATTGAATTTATTGG + Intronic
933341999 2:81036650-81036672 CTGAAAAAAATCGGATTTAGTGG - Intergenic
933495066 2:83040419-83040441 GGGAGAAAAATGGAATTCATTGG + Intergenic
933648221 2:84829193-84829215 GGGAGAAAAAGAGCATTTATTGG - Intronic
935338102 2:102035337-102035359 GTGAGACAAGTGGAATTTATTGG - Intergenic
935561363 2:104563460-104563482 ATGAGAAAAATGGAATTTATTGG + Intergenic
935724482 2:106011090-106011112 GTGAGAAAAATGGGATTTATTGG - Intergenic
935954734 2:108364479-108364501 GTTAGAAAAATTGCATATATTGG - Intergenic
936144106 2:109967680-109967702 GTTAGAGAAATGGGACTTCTAGG + Intergenic
936156892 2:110052942-110052964 GTGAGAAAAAAGGAGCTTATTGG + Intergenic
936180788 2:110265641-110265663 GTTAGAGAAATGGGACTTCTAGG + Intergenic
936187802 2:110318502-110318524 GTGAGAAAAAAGGAGCTTATTGG - Intergenic
936200581 2:110403789-110403811 GTTAGAGAAATGGGACTTCTAGG - Intronic
936738719 2:115477854-115477876 ATAAGGAAAATGGGATGTATAGG + Intronic
937301723 2:120846788-120846810 GCTAGAAACATGGGTTTTATAGG - Intronic
937455836 2:122040942-122040964 GAGAGAAAAAGGGGTTTTATGGG + Intergenic
937649002 2:124299037-124299059 GGAAGAAAAATGGAATTTATTGG + Intronic
938529518 2:132170290-132170312 GTGAGAAAAATGGAATTTATTGG + Intronic
939347368 2:140983260-140983282 GAGAAAAAAATGAGATATATTGG + Intronic
939837507 2:147149232-147149254 GGGAGGAGAATGGGATTTAGAGG + Intergenic
939840364 2:147180888-147180910 GTGAGAAAAATGGAACTTATTGG + Intergenic
940053291 2:149486798-149486820 GACAGAAAAATGTGATATATTGG - Intergenic
940389995 2:153121444-153121466 TTGAGGAGAATGGGATTAATAGG - Intergenic
940391118 2:153133497-153133519 GTGAGAAAAATTGAATTTATTGG - Intergenic
940566004 2:155360824-155360846 CTGAGACAGATGGAATTTATGGG - Intergenic
941249364 2:163143755-163143777 GTGAGAATAATGGAATTTATTGG - Intergenic
941249961 2:163148873-163148895 GTGAGAATAATGGGATTTATTGG - Intergenic
941792697 2:169570064-169570086 GTAAGAGAATTGGCATTTATAGG - Intronic
942822189 2:180127182-180127204 GTGAGAAAATTGGGAGCTTTGGG + Intergenic
943133597 2:183886895-183886917 CTGACAAAAATCGGATTTAGTGG - Intergenic
943409317 2:187526439-187526461 TTGACAAAAATGAAATTTATGGG + Intronic
943487895 2:188510682-188510704 ATGAGACAAGTGGGATTTTTAGG - Intronic
944673308 2:202014588-202014610 GTCAAAGAGATGGGATTTATAGG - Intergenic
944728815 2:202498208-202498230 CTGAGAAAAATCAGATTTAGTGG - Intronic
944964422 2:204914250-204914272 GTGAGAAAAATGGAATTTATTGG - Intronic
945051822 2:205831122-205831144 GTGAGAATAATGGAATTTATTGG - Intergenic
945382117 2:209153131-209153153 ATGAGAAAAAGGGGAATCATTGG - Intergenic
946207516 2:218120556-218120578 CTGAGAAAAATCAGATTTAGTGG + Intergenic
946297105 2:218794014-218794036 GTGAGAAAAATGGAATTTATTGG + Intronic
946439773 2:219685403-219685425 GTGAGAAAAATTGAATTTATTGG - Intergenic
946735353 2:222748648-222748670 GTGAGGGAAATGGGAGATATTGG - Intergenic
947136231 2:226979318-226979340 GTGAGAAAAGCAGAATTTATTGG + Intronic
947414112 2:229875885-229875907 GTGAGAGGATTGGGATTAATTGG - Intronic
1168748829 20:267750-267772 GTGAGAAAGAAGAGGTTTATGGG - Intergenic
1169967768 20:11236631-11236653 GTGAGAAAAATGGGATTTATTGG + Intergenic
1170335712 20:15267937-15267959 GTGAGAAAAACAGAATTTATTGG - Intronic
1170537527 20:17356240-17356262 ATTAGAAAAATGGGATAGATGGG - Intronic
1170780508 20:19421676-19421698 GTGAGAAAAACGGGATTTACTGG + Intronic
1170817469 20:19726773-19726795 GTAAGAAAAATGTGGTTTATGGG - Intergenic
1170916404 20:20630889-20630911 GTGGGGAAAATGGGAGTTATAGG - Intronic
1171261352 20:23737312-23737334 CTGAGAAAAATTGGATTTAGTGG - Intergenic
1171270487 20:23813203-23813225 CTGAGAAAAATTGGATTTAGTGG - Intergenic
1173283274 20:41648241-41648263 TTAAGCAAAAAGGGATTTATTGG + Intergenic
1173362373 20:42356138-42356160 GTGAGAAAAATGGGATGGGAGGG + Intronic
1174415224 20:50361652-50361674 ATGAGAAAAGTGGCATTTGTTGG + Intergenic
1174864245 20:54120237-54120259 GCTAGAAAAATGGTATATATGGG + Intergenic
1175163330 20:57024794-57024816 GTAAGGAAAAGGGAATTTATTGG + Intergenic
1176766994 21:13029622-13029644 GTAAGAAAAATGGAATTTATTGG - Intergenic
1176972752 21:15285846-15285868 GTGATAAAAAGGGATTTTATTGG + Intergenic
1177192408 21:17866631-17866653 GAGAGAATAATGGGATTTATAGG + Intergenic
1177405544 21:20662878-20662900 GTGAGGGGAATGGAATTTATTGG - Intergenic
1177543170 21:22521336-22521358 GTGCGAAAAATGGAATTTATTGG - Intergenic
1177759571 21:25388345-25388367 GTGAGAAAAATGGAATTTATGGG + Intergenic
1178044322 21:28676766-28676788 GTGAGAATAATGGAATTTATTGG - Intergenic
1178169656 21:30026026-30026048 GTGAGAAAAATGGAACTTTTTGG + Intergenic
1179392066 21:41003042-41003064 GTGAGAAAAAAGAAATTGATTGG + Intergenic
1180153116 21:45962558-45962580 GTGAGGGGAATGGAATTTATTGG + Intergenic
1180431564 22:15256000-15256022 GTGCGAAAAATGGAATTTATTGG - Intergenic
1180514123 22:16123912-16123934 GTGAGAAAAATGGAATTTATTGG - Intergenic
1180822804 22:18843255-18843277 GAGAGAAAAGGGGCATTTATTGG + Intergenic
1181209043 22:21277754-21277776 GAGAGAAAAGGGGCATTTATTGG + Intergenic
1181502863 22:23328443-23328465 GAGAGAAAAGGGGCATTTATCGG - Intergenic
1181653662 22:24276819-24276841 GAGAGAAAAGGGGCATTTATTGG - Intronic
1181900395 22:26150234-26150256 GAGAGATAAATTGCATTTATGGG + Intergenic
1203217896 22_KI270731v1_random:17694-17716 GAGAGAAAAGGGGCATTTATTGG - Intergenic
1203272941 22_KI270734v1_random:69163-69185 GAGAGAAAAGGGGCATTTATTGG + Intergenic
949098220 3:112159-112181 GTGAGAAAAATGGAATTTATTGG + Intergenic
949571638 3:5299646-5299668 GTGAGAAAAATGGAATTTATTGG + Intergenic
949705430 3:6811204-6811226 GGGATAAAAATGGCATTTTTGGG - Intronic
949811904 3:8015547-8015569 GTGAAAAAAATGGAATTTGTTGG + Intergenic
949812518 3:8021074-8021096 GTAAGAAAAATGGAATTTATTGG + Intergenic
949993169 3:9596188-9596210 ATGAGAAAAATGGGATTTATTGG - Intergenic
950033818 3:9869859-9869881 GTGAGCAAATTGGGATTTCCTGG - Intronic
950356206 3:12411733-12411755 TTGAGAACTATGAGATTTATAGG - Intronic
951062109 3:18221271-18221293 GTGAAAAAAATAGAATGTATAGG + Intronic
951378451 3:21952557-21952579 GTGAGAAAACTGAGGTTTAGGGG - Intronic
951908514 3:27726251-27726273 GTGAAAATAATAGTATTTATTGG - Intergenic
952636994 3:35544932-35544954 ATGAGAAAAATTGAATTTATTGG + Intergenic
953466925 3:43130091-43130113 TTGATAGAAATGGAATTTATTGG + Intergenic
953623112 3:44549537-44549559 CTAAGAAAAATTGGATTTAGTGG + Intergenic
954232420 3:49227610-49227632 CTGAGAAAAATCAGATTTAGTGG + Intronic
954598761 3:51851546-51851568 CTGAGAAAAAATGGATTTAGTGG - Intergenic
954968648 3:54633478-54633500 GTAAGAAAAATCGGATTTATTGG + Intronic
955037512 3:55283340-55283362 GTGAGAAAAATGGAACGTATTGG - Intergenic
955440382 3:58948539-58948561 GTGACAAAACTGGAATATATGGG - Intronic
956247717 3:67202945-67202967 GTGAGAAAAATGGGATTGATTGG - Intergenic
956843141 3:73158201-73158223 CTGAGAAAAATTGGATTTAGTGG + Intergenic
957560463 3:81814427-81814449 GGGAGAAAAAGGGCTTTTATGGG + Intergenic
957619826 3:82581388-82581410 GTGAGAAAAATGGAATTTATTGG + Intergenic
957671404 3:83307267-83307289 GTCAGAAAAATAGGATTTAATGG - Intergenic
957682704 3:83458301-83458323 GTGAGAAGAATGGATTTTTTGGG - Intergenic
958472346 3:94536817-94536839 GTGAGAAGAATGTGAATTTTGGG + Intergenic
958486266 3:94714317-94714339 GTGAGAGTAATGTTATTTATGGG + Intergenic
958549380 3:95594108-95594130 CCAAGAAAAATGGGATTTAGTGG + Intergenic
958744422 3:98114803-98114825 ATGAGAAAAATGGAATTTATTGG - Intergenic
959049349 3:101509855-101509877 ATGAGAAAACCGGGATTTAGGGG - Intronic
959330573 3:104999547-104999569 GTGGGGATTATGGGATTTATGGG - Intergenic
959401980 3:105913896-105913918 GTGAGGAAAATGGAATTTATTGG - Intergenic
959577234 3:107947610-107947632 GTGATGAAAATGAGATTTACTGG - Intergenic
959587958 3:108042819-108042841 CTAAGAAAAATGGGATCTATTGG - Intergenic
959680406 3:109089621-109089643 GAGAAAAAAATGCGATTTAATGG + Intronic
959820572 3:110730236-110730258 GTGAGAAAAATGGGATTTCTTGG - Intergenic
960063519 3:113347908-113347930 CCGAGAAAAATCGGATTTAGTGG - Intronic
960119766 3:113935797-113935819 ATGACAAAAATGAGGTTTATAGG + Intronic
960504693 3:118478632-118478654 ATGAGAAAAATGGAATTTATTGG - Intergenic
961179844 3:124867920-124867942 GTGAGGATTATGGGAATTATAGG - Intronic
961237810 3:125383369-125383391 GTGAGAAAAGTAGGATTTGGGGG + Intergenic
961717707 3:128870053-128870075 GTGAGCAAATTGGGATTTGCTGG + Intergenic
962147823 3:132858995-132859017 GAGAGAAAAATGTGTTTTTTTGG - Intergenic
962286896 3:134093801-134093823 CCGAGAAAAGTGGGATTGATCGG - Intronic
962790479 3:138806735-138806757 GTGAGAAAATAGAGATTTCTTGG + Intronic
963024668 3:140907638-140907660 GTGAGAAAACTGGGTCTTAGAGG - Intergenic
963219372 3:142790348-142790370 CTGAGTAAAATGGGATTTAAGGG + Intronic
963435837 3:145265081-145265103 GTGAGAAAAATTGATTTCATGGG + Intergenic
963696573 3:148572233-148572255 CTGAGAAAAATCAGATTTAGTGG - Intergenic
964064336 3:152561280-152561302 CCGAGAAAAATCGGATTTAGTGG - Intergenic
964073078 3:152659014-152659036 GTGAGAAAAATGGAATTTATTGG + Intergenic
964499760 3:157335759-157335781 GGGAAAAAGATGGGAGTTATTGG + Intronic
964504844 3:157387953-157387975 GAGAGAAAAATGTGGATTATAGG - Intronic
964972085 3:162575909-162575931 CTGAGAAAAATCAGATTTAGTGG - Intergenic
965062594 3:163803064-163803086 CCGAGAAAAATCGGATTTAGTGG - Intergenic
965158581 3:165099348-165099370 GTCTGTAAAATGGGAATTATGGG - Intergenic
965483735 3:169252395-169252417 GTTAGAAAACGGAGATTTATGGG + Intronic
965671591 3:171153340-171153362 ATAAGAAAAATAGGAATTATTGG - Intronic
965894077 3:173552554-173552576 GTGAGAATAATGGGATTTATTGG + Intronic
966112211 3:176416932-176416954 GTGAGAAAAATAGAATATATTGG + Intergenic
966375907 3:179295442-179295464 GAGAGAAAATTATGATTTATGGG - Intergenic
966950487 3:184812517-184812539 TTAAGTAAAAAGGGATTTATTGG + Intronic
967256065 3:187593335-187593357 GTGAGAAAAATGGAATTTATTGG + Intergenic
967531616 3:190554238-190554260 GTGAGAAAAATGGAATTTATTGG + Intronic
967546206 3:190731899-190731921 GTGAGGGGAATGGAATTTATTGG + Intergenic
967583468 3:191186903-191186925 CTGAGAAAAATTGGATTTAGTGG - Intergenic
967657150 3:192063932-192063954 GCGAGAATAATGGGATTTACTGG - Intergenic
967691599 3:192480270-192480292 GGGAGAAAAATAGGTTTTGTTGG - Intronic
969073785 4:4561063-4561085 GTGAGGAAAACAGAATTTATTGG + Intergenic
970533376 4:17004613-17004635 GTGAGAAAAATGGGCTTGGACGG + Intergenic
970721339 4:18992748-18992770 GAGAAAAAAATGGAATTTATTGG - Intergenic
971329175 4:25668348-25668370 GTTAGAAGAGTAGGATTTATTGG + Intronic
971578321 4:28304484-28304506 CTGAGAAAAATCAGATTTAGTGG - Intergenic
971998300 4:33995294-33995316 GTGAGGAAAATGGGATTTATTGG - Intergenic
972679356 4:41290532-41290554 GTGAGAAAAATGAAATCTATTGG + Intergenic
972798579 4:42448171-42448193 GTGAGAAAAATGGTATTGTTTGG + Intronic
973045701 4:45532838-45532860 CTGAGAAAAATCGGATTTAGTGG - Intergenic
973226484 4:47790477-47790499 GTGAGAAAACTGGAATTTATCGG - Intronic
974200931 4:58639570-58639592 ATGAGAAAACTGGTATTTAGAGG - Intergenic
974536967 4:63186024-63186046 CTGAGAAAAATCAGATTTAGTGG - Intergenic
974693144 4:65327866-65327888 GGTAGTAAAATGGGAATTATTGG - Intronic
974839021 4:67280912-67280934 CTGAGAAAAATCAGATTTAGTGG + Intergenic
975047839 4:69826311-69826333 CTGAGAAAAATCAGATTTAGTGG - Intronic
975279890 4:72549444-72549466 GTGAGAAAACTGAGATTCAGGGG + Intronic
975424300 4:74208602-74208624 GTGAGAAAAATGGAATTTATTGG + Intronic
976174489 4:82337644-82337666 CTGAGAAAAATCGGATTTAGTGG + Intergenic
976690722 4:87864400-87864422 GTGAGAATAATGGGATTTACTGG + Intergenic
977022404 4:91774073-91774095 TTGGGAACAATGGGATGTATTGG + Intergenic
977227685 4:94412792-94412814 GTGAGAGAAATGACATTTCTTGG - Intergenic
977891863 4:102321544-102321566 GTGAGGAGAATGGAATTTATTGG - Intronic
977900500 4:102416818-102416840 GAGAGCAAAATGGCTTTTATTGG + Intronic
978039032 4:104035750-104035772 ATGAGAAAAATCGGGTTTACTGG - Intergenic
978227544 4:106355545-106355567 GTGAGAAAAACGGAATTTATTGG - Intergenic
978978248 4:114907829-114907851 ATGAGAAAAAAAGGCTTTATTGG + Intronic
979155452 4:117382806-117382828 GTGAGAAAAATGGGAGTACCTGG - Intergenic
979410908 4:120378237-120378259 ATGAGAAGAATAGGTTTTATAGG + Intergenic
979507516 4:121514863-121514885 GTGAGAAAAATGGAATTTATTGG - Intergenic
979609389 4:122673326-122673348 GTGAGAAAAACAGAATTTATTGG + Intergenic
980340490 4:131539126-131539148 GTGAAAAAAATAGGAATCATAGG - Intergenic
980479386 4:133367401-133367423 GTGAGGAAAACGGAATTTTTTGG - Intergenic
981399782 4:144300917-144300939 GTAAGAAGCATGGGATTTCTTGG - Intergenic
981531199 4:145755297-145755319 GTGAGAAAATTTGGATTACTTGG - Intronic
981871590 4:149493255-149493277 TTGAGAAAAAGGGGATCTAGAGG + Intergenic
982371251 4:154636075-154636097 GTGAAAAAATTGGGCTTTAAAGG - Intronic
982475262 4:155842830-155842852 GTGAGGAAAATGGAATTTATTGG + Intronic
984021063 4:174485371-174485393 GTGAGGAGCAAGGGATTTATAGG + Intergenic
984099763 4:175471488-175471510 GTGAGAAAAATGGAATTTATTGG + Intergenic
984414909 4:179446041-179446063 GTGAGAGAAATAGAACTTATTGG + Intergenic
986213321 5:5694714-5694736 GTGAGAAAAAAAGAATTTATTGG - Intergenic
986213883 5:5699599-5699621 GTGAGAAAAATGGAATTTATTGG - Intergenic
986625120 5:9716357-9716379 GTGAGAAAAGCAGGGTTTATTGG - Intergenic
986691326 5:10316195-10316217 GTGAGAAAAACGGGGTTTATTGG + Intergenic
987155102 5:15081417-15081439 ATGATAATTATGGGATTTATTGG + Intergenic
987505492 5:18765535-18765557 GTGGAAAAAATGGGTTTTATAGG + Intergenic
987545417 5:19305991-19306013 CTGAGAAAAATCAGATTTAGTGG + Intergenic
988585942 5:32507688-32507710 GTGAGGAAAATGGAATTTATTGG + Intergenic
988592198 5:32558473-32558495 CTGAGAAAAATCGGATTTAGTGG + Intronic
988605687 5:32676673-32676695 CTGAGAAAAATTGGATTTAGTGG + Intergenic
988659268 5:33246762-33246784 GTGAGAAAACTGGAATTTATTGG - Intergenic
988849358 5:35163214-35163236 GGGAGAAAAATGAAATTTATTGG - Intronic
989220481 5:38955877-38955899 GTGAGGAAAATGGCAGATATGGG - Intronic
990116574 5:52398777-52398799 CTGAGAAAAATTGGATTTAGTGG - Intergenic
990342831 5:54840958-54840980 GTAAGTAAAATGAGAGTTATAGG + Intergenic
990582495 5:57179022-57179044 ATGAGAAAATTAGGATTTAGGGG + Intronic
990800046 5:59590925-59590947 ATGAGAGAAAAGGGTTTTATTGG - Intronic
991531456 5:67619742-67619764 CTGAGAAAAATGTGAATTAATGG + Intergenic
991675191 5:69083713-69083735 GTGAGAAAAGTAGAATTTATTGG - Intergenic
992455025 5:76908888-76908910 CTGAGAAAAATCGGATTTAGTGG - Intronic
992545593 5:77811415-77811437 GTGAGGAAGATCGGATTTAGTGG - Intronic
992847071 5:80761159-80761181 AGGAGAAAAATGGAATTTATTGG + Intronic
993126974 5:83847300-83847322 CTGAGAAAAATAGGAACTATAGG - Intergenic
993536393 5:89092076-89092098 GTGAGACAAATGAGATGCATGGG - Intergenic
994093333 5:95827268-95827290 GTGAGGAAAATGGAATTTATTGG - Intergenic
994231900 5:97316787-97316809 CCGAGAAAAATCGGATTTAGTGG + Intergenic
994313407 5:98303706-98303728 GTAAAAAACATGGGATTTTTAGG + Intergenic
994537273 5:101048239-101048261 GAGAGACAAATGGCCTTTATAGG - Intergenic
994720627 5:103375975-103375997 GTGAGAAAAAGGGTGTTTCTGGG - Intergenic
995583611 5:113624489-113624511 CTGAGAAAAATCAGATTTAGTGG + Intergenic
995599364 5:113778989-113779011 GTGTGAAAAATGTGAATTATGGG - Intergenic
996099412 5:119431459-119431481 CCGAGAAAAATCGGATTTAGTGG + Intergenic
996266711 5:121550021-121550043 TTCAGAAAAATGTCATTTATGGG + Intergenic
996680205 5:126222771-126222793 CTGAGAAAAATCGGATTTAGTGG - Intergenic
996685999 5:126281401-126281423 GGGAGAAAAAAGTGATTTAGAGG + Intergenic
997072224 5:130634990-130635012 CCGAGAAAAATCGGATTTAGTGG - Intergenic
997082723 5:130759392-130759414 GTGAGAAAAATGGAATTTATTGG - Intergenic
997150150 5:131484919-131484941 ATCTGAAAAATGGGATTTTTGGG + Intronic
997158965 5:131587111-131587133 ATGAGAATAATGGAATCTATTGG - Intronic
997174962 5:131765832-131765854 GTGACAAAATTAGGTTTTATAGG - Intronic
997629748 5:135357987-135358009 GATAGAAAAATGAGATTCATAGG + Intronic
997806078 5:136919467-136919489 GGGTGAAAAATGGTATTTAAGGG + Intergenic
998651099 5:144122641-144122663 GTGAGAAAAATGGAATTTAGTGG + Intergenic
998817980 5:146032726-146032748 CAGAGAGAAATGTGATTTATGGG - Intronic
998914885 5:147002543-147002565 CCGAGAAAAATCGGATTTAGTGG - Intronic
998991398 5:147821754-147821776 GTGAGAAAAACGGAATTTATCGG + Intergenic
999708866 5:154298622-154298644 GTGAGAAAACTGGGGCTTAAAGG + Intronic
999842329 5:155441877-155441899 GTGAGAAAAATTGCATTGAATGG + Intergenic
1000248573 5:159470817-159470839 GTGAAGAAAGTGGGATTTGTTGG + Intergenic
1000844889 5:166267082-166267104 GAGAGAAAAATGGAATTTCGAGG - Intergenic
1000949723 5:167465882-167465904 ATGAGAAACCTGGGATGTATGGG + Intronic
1000970689 5:167711070-167711092 GTGAGAAAAATGGGGCTCAGAGG + Intronic
1001915215 5:175554861-175554883 GTGAGAAAAGTGGAATGTATTGG + Intergenic
1002525166 5:179811542-179811564 GTGAGAAAAATGGAATTTATTGG - Intronic
1002997296 6:2298858-2298880 GTGAGGACAGTGGAATTTATTGG + Intergenic
1003805610 6:9723616-9723638 CTGAGAAAAATCAGATTTAGTGG - Intronic
1004059763 6:12181857-12181879 GAGAAAAAAATGGGATTTTAAGG - Intergenic
1004302498 6:14471106-14471128 GTGTGAAAAATTGGAGTGATTGG + Intergenic
1005309759 6:24548271-24548293 GTGAGAAAAATGGAATTTATTGG + Intronic
1005762921 6:28984474-28984496 TTGAGAAAATTGGGATTTGGGGG - Intergenic
1008112628 6:47509378-47509400 GTTGGAAAAATGGCATTGATGGG + Intronic
1008149372 6:47931902-47931924 GTGAGAAAATTGAGATTCAAAGG + Intronic
1009470600 6:64025935-64025957 CCAAGAAAAATCGGATTTATTGG - Intronic
1010368086 6:75076048-75076070 GGGAGAAAAAAGGAATTTATTGG + Intergenic
1011591305 6:88972829-88972851 GTGAGAATAATGAAATTTACTGG - Intergenic
1012068259 6:94577533-94577555 GAAAAAAAAATGGGTTTTATGGG - Intergenic
1012520763 6:100118566-100118588 GTGAGAATAATGGGATTTGTTGG + Intergenic
1012566413 6:100660711-100660733 ATGAGAAAATTGGGACTTTTAGG - Intronic
1012809047 6:103934757-103934779 GTGAGAAAATGGGGATATCTAGG + Intergenic
1012854524 6:104486306-104486328 CTAAGAAAAATGAGATTTACTGG + Intergenic
1013388902 6:109663199-109663221 GTGAGAAGATTGAGATTTCTGGG - Intronic
1013455454 6:110325712-110325734 GTGAGAAAAATGGAATTTACTGG + Intronic
1013502141 6:110763189-110763211 ATGAGAAAGATGGGATTAAATGG - Intronic
1013777801 6:113698338-113698360 GTCAGAAAAATGGCAACTATGGG - Intergenic
1013819260 6:114135324-114135346 GTGAGAAAACAGGGTTTTCTGGG + Intronic
1013977241 6:116092485-116092507 CCGAGAAAAATTGGATTTAGTGG - Intergenic
1014181713 6:118391717-118391739 TTGAGAAAACTGGGGTTTTTTGG - Intergenic
1014195504 6:118553876-118553898 GTGAGAAAAATGAGGCTTAGAGG - Intronic
1014452416 6:121596466-121596488 GTGAGAATAATGGGATCTATTGG - Intergenic
1014545466 6:122730298-122730320 GTGAGAAGACTGGGATTCTTTGG + Intergenic
1014747637 6:125218878-125218900 GTGAGAAAAATGGAATTTATTGG + Intronic
1014776132 6:125511815-125511837 GTGAATTAAATGGGACTTATGGG - Intergenic
1014801408 6:125782126-125782148 ATGAGAATAATTGGATATATTGG + Intronic
1014953379 6:127586302-127586324 GTGAGGGGAATGGAATTTATGGG + Intronic
1015167786 6:130218154-130218176 GTCAGAAGAATGGAATTTATTGG + Intronic
1015490461 6:133819113-133819135 TTTAGAAAAATGAGATTTCTGGG - Intergenic
1015803138 6:137080803-137080825 GTGAGAATTATGGAATTTATTGG + Intergenic
1016233509 6:141833560-141833582 CTGAGGAAAATGGAATTCATTGG - Intergenic
1016633024 6:146254082-146254104 ATTAGGAAAATAGGATTTATTGG + Intronic
1016686113 6:146884159-146884181 GTGAGAATAATGGAATTTATTGG - Intergenic
1016814335 6:148289834-148289856 GTGAGGAAAATGGTTTTTTTTGG + Intronic
1017854715 6:158340186-158340208 TAGAGAAAAATGGGTTTTTTGGG + Intronic
1018260921 6:161969856-161969878 GTGAGAAAAATGGAATTTATTGG - Intronic
1018624161 6:165761175-165761197 GTTAGAAAAATGGAGTTTATTGG - Intronic
1018680055 6:166257206-166257228 GTGAGGATTATGGGAATTATGGG - Intergenic
1019231662 6:170570509-170570531 CTGAGAAAAATGAGATTACTAGG + Intronic
1020466544 7:8486073-8486095 GGGAAAGAAATGGCATTTATGGG - Intronic
1020691062 7:11355127-11355149 GTGAGAATGTTGGCATTTATGGG + Intergenic
1020731452 7:11886340-11886362 GTGAGTAAAAGGGGATATCTAGG + Intergenic
1021002452 7:15349569-15349591 CTGAGAAGAATAGGATTTCTAGG - Intronic
1021018526 7:15566743-15566765 GTGAGGAAAAAGAGATTTAATGG + Intergenic
1021070145 7:16228046-16228068 GCTATAAACATGGGATTTATGGG + Intronic
1021158519 7:17242295-17242317 GTGAGGAAAATGAGCATTATGGG - Intergenic
1021180566 7:17500782-17500804 AAGAGAAAAATGGAATGTATTGG + Intergenic
1022084475 7:27053215-27053237 GTGAGAAAGGCAGGATTTATTGG + Intergenic
1022322059 7:29297094-29297116 GTGAGAAAAATGGAATTTATTGG + Intronic
1022322362 7:29299013-29299035 GTGAGCAAAATTGAATTTATTGG + Intronic
1022797034 7:33739929-33739951 GAGAAACAAATGGGATTTTTAGG + Intergenic
1022945271 7:35277948-35277970 GACAGATAAATAGGATTTATGGG + Intergenic
1023299715 7:38757222-38757244 GTAATAAAAATGGTCTTTATTGG + Intronic
1023359519 7:39400934-39400956 GTGAGATAAACAGGATTTATTGG + Intronic
1023488970 7:40717281-40717303 GTGAGGAAAATGGAATTTATTGG + Intronic
1023694116 7:42827030-42827052 TTGAGAAAAATGGTATTCAATGG - Intergenic
1024035273 7:45502903-45502925 GTGAGAAAAATGGAATTTATTGG + Intergenic
1024112602 7:46162382-46162404 GTGAGAAAAATGGGATTTATTGG + Intergenic
1024331755 7:48161953-48161975 GTGAGTGAAGTGGGATTTATTGG - Intergenic
1024735109 7:52296287-52296309 CTGAGAAAAATTGGATTTAGTGG - Intergenic
1024898199 7:54285099-54285121 GTGAGAAAAAGTGGGTTTTTCGG - Intergenic
1025255268 7:57380540-57380562 GTGAGAGAAGTGGCATTTGTTGG - Intergenic
1026463448 7:70634163-70634185 ATGAGTAAAATGGGATCTGTTGG + Intronic
1027527928 7:79294324-79294346 GTGCGAAAAATAGAATTTATTGG + Intronic
1027541907 7:79477440-79477462 GTGAGAAAAATTGAAGATATGGG + Intergenic
1027682415 7:81237496-81237518 GTTAGAAAAATGGGAGGTTTGGG - Intergenic
1027790940 7:82638484-82638506 CTGAGAAAAATTGGATTTCGTGG - Intergenic
1028235894 7:88361271-88361293 GTGAGAAAAATGGGATTTATTGG + Intergenic
1028495402 7:91454932-91454954 CTGAGAAAAATCGGATTTAGTGG + Intergenic
1029255067 7:99264089-99264111 GTGAGGAAAATGAGATCTACCGG - Intergenic
1029666530 7:101998673-101998695 GTGAAAAAAATTGGTTTTTTTGG + Intronic
1030078046 7:105753565-105753587 GTGACTAAAATGGGATCTTTGGG + Intronic
1030293979 7:107900927-107900949 TTGAGAAGAATGGGAGTAATTGG + Intronic
1030399408 7:109029424-109029446 GGGAGAGAAATGGGATTTGGAGG + Intergenic
1030420333 7:109300590-109300612 CTGAGAAAAATTGGATTTAGTGG - Intergenic
1030600542 7:111587093-111587115 GGGAGAATAATGTGATTAATTGG - Intergenic
1031020996 7:116627202-116627224 GTGAGAAAAATGGAATTTATTGG - Intergenic
1031099733 7:117464991-117465013 GTGATAAAAATAGGATTTTATGG + Intergenic
1031105592 7:117538468-117538490 CTGAGAAAAATGGGAAGAATAGG - Intronic
1031584509 7:123518328-123518350 GTGAGAATAATGGATTTTTTTGG - Intronic
1032728829 7:134617405-134617427 GTGAGATAAAAGAGATTTATGGG + Intergenic
1033083176 7:138317475-138317497 GTGAGAATAATGGGATTTATTGG + Intergenic
1033464337 7:141577514-141577536 GTGAGAAAAATGGAATTTATTGG + Intronic
1033865561 7:145687025-145687047 GTGAGAAAAATGGAATTTATTGG - Intergenic
1033866216 7:145692881-145692903 GTGAGAAAAAAGGAATTTATTGG - Intergenic
1034568532 7:151935372-151935394 GTGAGAGAAATGGAAATTAAAGG + Intergenic
1034580173 7:152034890-152034912 CCGAGAAAAATTGGATTTAGTGG + Intronic
1034750644 7:153565820-153565842 GTTAGAAAAATAAGATTTAATGG + Intergenic
1035489474 7:159260523-159260545 GTGAGAAAGATGGGCTGTATTGG - Intergenic
1035575783 8:703783-703805 GTAAGAAAAAGGGGATCTATTGG + Intronic
1035936296 8:3844540-3844562 GAGGGAAAAATTGGATTTTTAGG + Intronic
1037152160 8:15649975-15649997 AACAGAAAAATGGCATTTATAGG - Intronic
1037259857 8:16996196-16996218 GTGAGAAAAATGGAATTTATTGG - Intronic
1037279782 8:17226222-17226244 ATGGGAATAATGGGATTTTTTGG + Intergenic
1037623824 8:20590473-20590495 GTGAGAATAAAGGGGTTTATTGG - Intergenic
1038370291 8:26982094-26982116 GTGAGAAAACTGGAACTTATTGG - Intergenic
1038704880 8:29884316-29884338 ATGATAAAAATGGTACTTATTGG + Intergenic
1039199850 8:35078605-35078627 GTAAGAAAAAGGGGAATTAAAGG + Intergenic
1039999879 8:42566839-42566861 CTGAGAAAAATCGGATTTGGTGG + Intergenic
1040664378 8:49615329-49615351 GTGAGAAAAATGGAATTTACTGG + Intergenic
1040668043 8:49655531-49655553 CTGAGAAAAATTGGATTTAGTGG + Intergenic
1041000111 8:53441466-53441488 TCGAGAAAAATCGGATTTAGTGG + Intergenic
1041001720 8:53460978-53461000 CTGAGAAAAATCAGATTTAGTGG - Intergenic
1041299104 8:56392488-56392510 CTGAGAAAAATTCTATTTATAGG + Intergenic
1041400092 8:57433656-57433678 GTGAAAATAATGGGATTTTGTGG + Intergenic
1042451686 8:68954849-68954871 GTGAGAGAAATGGAATTTATTGG - Intergenic
1042771738 8:72389430-72389452 ACGAGAAAAATCGGATTTAGTGG - Intergenic
1043074535 8:75681478-75681500 GTCAGAAAAATAAGAATTATAGG + Intergenic
1043764349 8:84110749-84110771 GTGAGAGAAATGTGATTCAGTGG - Intergenic
1043796689 8:84550725-84550747 GTCAGAATAATAGTATTTATAGG - Intronic
1044635745 8:94322152-94322174 GTGAGCACAATGGGCTTGATGGG - Intergenic
1045093160 8:98768280-98768302 GTGAGAAAAACCTGATTTTTGGG - Intronic
1045262624 8:100590095-100590117 TAGTGGAAAATGGGATTTATTGG - Intronic
1046068589 8:109223687-109223709 GTGAGTAAACAGGGTTTTATTGG - Intergenic
1046090598 8:109498655-109498677 GTGGGAGAAGTGGGATTTGTTGG + Exonic
1046132181 8:109979368-109979390 ATGAGGAAAATGAGATTTACAGG - Intergenic
1046754442 8:117958848-117958870 GTGAGAGAAATGGCATATTTAGG - Intronic
1047154622 8:122302965-122302987 GAGAGAAAAAAGGAATATATTGG + Intergenic
1047588692 8:126302932-126302954 GTGAGAAAAATGGAATTTATTGG - Intergenic
1047643885 8:126849786-126849808 GTGAGAAAACAGTGAGTTATTGG + Intergenic
1047713427 8:127574353-127574375 GTGAGAAAACTGAGGTTTAGAGG - Intergenic
1048649083 8:136454216-136454238 GTGAGAATAATAGGATTTATTGG - Intergenic
1048742723 8:137580055-137580077 GTGAGAAAAATGGAATGTATTGG + Intergenic
1049440125 8:142605796-142605818 GTGAGAAGAATGGGAGTTTTGGG - Intergenic
1049954337 9:678433-678455 GTAAGAAAAATCAGAATTATGGG + Intronic
1049989780 9:979590-979612 TTTAAAAAAATGGGAATTATGGG - Intronic
1050289958 9:4143713-4143735 GTGGGGAAAATGGGAGATATTGG - Intronic
1050663251 9:7906924-7906946 GTGAGAAAACTGGGTTTGCTGGG - Intergenic
1051029069 9:12652288-12652310 GTCAGAATAATGGGCTTTAGAGG + Intergenic
1052230568 9:26145973-26145995 GTGAGAATAATGGGATTTATTGG + Intergenic
1053708119 9:40776550-40776572 GTGAGAAAAATGGAATTTATTGG + Intergenic
1054418029 9:64897336-64897358 GTGAGAAAAATGGAATTTATTGG + Intergenic
1055088273 9:72336418-72336440 ATGAGAATAACGTGATTTATTGG - Intergenic
1055248125 9:74271731-74271753 TTGTGAAAAATGGAATTTCTGGG + Intergenic
1055334607 9:75220460-75220482 GTGAGAAATATGGCATTGATGGG + Intergenic
1055569409 9:77601216-77601238 GTGAGGGGAATGGAATTTATTGG - Intronic
1056045921 9:82715774-82715796 GTGAGAGAAATTGTATTTTTGGG - Intergenic
1056135662 9:83627459-83627481 GTGAGAAAACTGAGGTTTAAAGG + Intronic
1056889838 9:90480876-90480898 GTGAGGAAAATGGAATTTACTGG - Intergenic
1056914431 9:90733247-90733269 GTGAGAAAAATGGGATTTATTGG + Intergenic
1057916734 9:99062162-99062184 CAGAAAAAAATGGCATTTATGGG - Intronic
1058058111 9:100469507-100469529 GTAAACAAAAAGGGATTTATTGG - Intronic
1058142802 9:101375855-101375877 GTGAGAAAAATGGAACTTATTGG - Intronic
1059811061 9:117856211-117856233 GTGAGAAAAATGAAATTTATTGG + Intergenic
1059854412 9:118380071-118380093 GTGAGAACAATGTTAGTTATAGG + Intergenic
1060653899 9:125354999-125355021 AGGAGAAAAATGCAATTTATTGG - Intronic
1185516500 X:702842-702864 CTAAGGAAAAGGGGATTTATAGG - Intergenic
1185880036 X:3732649-3732671 GTGAGAAAAATGGAATTTATTGG + Intergenic
1186619428 X:11222125-11222147 GTGAGAAACATGTAATTAATTGG + Intronic
1186826220 X:13342707-13342729 GTGAGGAAAATGGGAGATGTTGG - Intergenic
1186939465 X:14489448-14489470 GTGAGAAAAATGGGATTTATTGG + Intergenic
1187071270 X:15891290-15891312 TTAAGTAAAAAGGGATTTATTGG + Intergenic
1187842884 X:23506900-23506922 GTGAGGAAAATGGAATTTATTGG - Intergenic
1188136310 X:26498783-26498805 CCGAGAAAAATTGGATTTAGTGG - Intergenic
1188375280 X:29421219-29421241 GTGGGAAAAATGGAATTTATTGG + Intronic
1188418988 X:29973221-29973243 GTGAGAAAAAAAGGATGTGTGGG + Intergenic
1188763362 X:34058500-34058522 GTGAAAAAAATGGAATTATTTGG - Intergenic
1189205554 X:39235469-39235491 GTGAGAAGAATCTGATTTAAGGG - Intergenic
1189917364 X:45869464-45869486 GTAAGAATAATGGGTTCTATGGG + Intergenic
1190549452 X:51563716-51563738 CTGAGGGAAATGGAATTTATTGG + Intergenic
1190576780 X:51847526-51847548 GTGAGGGGAATGGAATTTATTGG + Intronic
1191206134 X:57835608-57835630 CTGAGAAAAATCGGATTTAGTGG + Intergenic
1191645055 X:63471093-63471115 GTGAGAAAAATGAAATTTATTGG + Intergenic
1191737862 X:64406402-64406424 ATGAGAAAAAGAGGATTAATTGG + Intergenic
1192595845 X:72407448-72407470 GTGAGAATAATGGGATTTATTGG - Intronic
1192851964 X:74966349-74966371 GTGGGAAAAATTGGAGATATGGG + Intergenic
1192870232 X:75177444-75177466 CCGAGAAAAATCGGATTTAGTGG + Intergenic
1193481255 X:82032113-82032135 AGGAGACAAATGGAATTTATTGG - Intergenic
1193481844 X:82036457-82036479 GGGAGAAAAATGGGACTTACTGG - Intergenic
1193547604 X:82849181-82849203 ATGTTAAAGATGGGATTTATTGG + Intergenic
1194088882 X:89562133-89562155 GTGAGGGGAATGGAATTTATTGG + Intergenic
1194680272 X:96843609-96843631 GCAAGACAAATGGAATTTATGGG + Intronic
1194758373 X:97764386-97764408 GTGACAAAAAGGAGATTTGTTGG + Intergenic
1195439368 X:104884061-104884083 CTGAGAAAAATCGGATTTAGCGG - Intronic
1195970252 X:110465192-110465214 GTGAGCAAAAGGGGCCTTATTGG + Intergenic
1196419594 X:115508253-115508275 CCGAGAAAAATCGGATTTAGTGG + Intergenic
1196488792 X:116244893-116244915 CCGAGAAAAATCGGATTTAGTGG - Intergenic
1197513213 X:127396417-127396439 CTGAGAAAAATCGGATTTAGTGG - Intergenic
1197837053 X:130705916-130705938 GTGAGAAAAATGGAATGTATTGG - Intronic
1198188594 X:134280964-134280986 GTGAGAAAGATGGGATTGGGGGG + Intergenic
1198939204 X:141934576-141934598 GTGAGGAAAATGGAACTTATTGG - Intergenic
1199058978 X:143330532-143330554 GTGAGAAAAATGGAATTTACTGG - Intergenic
1199148698 X:144402847-144402869 TTGAGAAAACTGGGGTTTACAGG - Intergenic
1199305360 X:146261301-146261323 GTGTGAGAAATGGGAGTGATGGG - Intergenic
1199372944 X:147073048-147073070 GTTAGAAAAATGGAATTTATTGG + Intergenic
1200441558 Y:3218185-3218207 GTGAGGGGAATGGAATTTATTGG + Intergenic
1200711090 Y:6485674-6485696 ATGAGAAAAATCAGATTTAGTGG - Intergenic
1200785735 Y:7258900-7258922 GACAGAAAAATGGAATTTATTGG + Intergenic
1200785829 Y:7259559-7259581 GTGAGAAAAATGGAATTTATTGG - Intergenic
1201022844 Y:9676312-9676334 ATGAGAAAAATCAGATTTAGTGG + Intergenic
1201309906 Y:12587565-12587587 GAGAGAAAAACAGAATTTATTGG - Intergenic
1201496587 Y:14595932-14595954 CTGAGAAAAATCGGATTTAGTGG + Intronic
1201516133 Y:14820230-14820252 CTGAGAAAAATCAGATTTAGTGG + Intronic
1202074879 Y:21027651-21027673 CTGAGAAAAATTGGATTTAGTGG + Intergenic
1202192794 Y:22261459-22261481 CTGAGAAAAATTGGATTTAGTGG + Intergenic
1202257663 Y:22938529-22938551 CTGAGAAAAATCGGATTTAGTGG - Intergenic
1202272263 Y:23083533-23083555 CTGAGAAAAATCGGATTTAGTGG + Intergenic
1202293763 Y:23337149-23337171 CTGAGAAAAATCGGATTTAGTGG - Intergenic
1202410653 Y:24572276-24572298 CTGAGAAAAATCGGATTTAGTGG - Intergenic
1202425260 Y:24717277-24717299 CTGAGAAAAATCGGATTTAGTGG + Intergenic
1202445529 Y:24952808-24952830 CTGAGAAAAATCGGATTTAGTGG - Intergenic
1202460128 Y:25097796-25097818 CTGAGAAAAATCGGATTTAGTGG + Intergenic