ID: 935724483

View in Genome Browser
Species Human (GRCh38)
Location 2:106011099-106011121
Sequence ATTTGAAGGGTGAGAAAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935724483_935724490 15 Left 935724483 2:106011099-106011121 CCCATTTTTCTCACCCTTCAAAT No data
Right 935724490 2:106011137-106011159 TTTTTCATGGTCATGTGACAAGG No data
935724483_935724487 2 Left 935724483 2:106011099-106011121 CCCATTTTTCTCACCCTTCAAAT No data
Right 935724487 2:106011124-106011146 TCCACGAGCCTAATTTTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935724483 Original CRISPR ATTTGAAGGGTGAGAAAAAT GGG (reversed) Intergenic
No off target data available for this crispr