ID: 935724484

View in Genome Browser
Species Human (GRCh38)
Location 2:106011100-106011122
Sequence AATTTGAAGGGTGAGAAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935724484_935724487 1 Left 935724484 2:106011100-106011122 CCATTTTTCTCACCCTTCAAATT No data
Right 935724487 2:106011124-106011146 TCCACGAGCCTAATTTTTCATGG No data
935724484_935724490 14 Left 935724484 2:106011100-106011122 CCATTTTTCTCACCCTTCAAATT No data
Right 935724490 2:106011137-106011159 TTTTTCATGGTCATGTGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935724484 Original CRISPR AATTTGAAGGGTGAGAAAAA TGG (reversed) Intergenic