ID: 935724485

View in Genome Browser
Species Human (GRCh38)
Location 2:106011112-106011134
Sequence AGGCTCGTGGACAATTTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935724485_935724492 26 Left 935724485 2:106011112-106011134 CCCTTCAAATTGTCCACGAGCCT No data
Right 935724492 2:106011161-106011183 CCCCATCTTTAGCTGAACTAAGG 0: 49
1: 99
2: 135
3: 181
4: 258
935724485_935724490 2 Left 935724485 2:106011112-106011134 CCCTTCAAATTGTCCACGAGCCT No data
Right 935724490 2:106011137-106011159 TTTTTCATGGTCATGTGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935724485 Original CRISPR AGGCTCGTGGACAATTTGAA GGG (reversed) Intergenic
No off target data available for this crispr