ID: 935724486

View in Genome Browser
Species Human (GRCh38)
Location 2:106011113-106011135
Sequence TAGGCTCGTGGACAATTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935724486_935724492 25 Left 935724486 2:106011113-106011135 CCTTCAAATTGTCCACGAGCCTA No data
Right 935724492 2:106011161-106011183 CCCCATCTTTAGCTGAACTAAGG 0: 49
1: 99
2: 135
3: 181
4: 258
935724486_935724490 1 Left 935724486 2:106011113-106011135 CCTTCAAATTGTCCACGAGCCTA No data
Right 935724490 2:106011137-106011159 TTTTTCATGGTCATGTGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935724486 Original CRISPR TAGGCTCGTGGACAATTTGA AGG (reversed) Intergenic
No off target data available for this crispr