ID: 935724487

View in Genome Browser
Species Human (GRCh38)
Location 2:106011124-106011146
Sequence TCCACGAGCCTAATTTTTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935724478_935724487 28 Left 935724478 2:106011073-106011095 CCTGTTTCCCTTTTTTCCCAATA No data
Right 935724487 2:106011124-106011146 TCCACGAGCCTAATTTTTCATGG No data
935724482_935724487 11 Left 935724482 2:106011090-106011112 CCAATAAATCCCATTTTTCTCAC 0: 10
1: 67
2: 63
3: 124
4: 487
Right 935724487 2:106011124-106011146 TCCACGAGCCTAATTTTTCATGG No data
935724480_935724487 20 Left 935724480 2:106011081-106011103 CCTTTTTTCCCAATAAATCCCAT No data
Right 935724487 2:106011124-106011146 TCCACGAGCCTAATTTTTCATGG No data
935724479_935724487 21 Left 935724479 2:106011080-106011102 CCCTTTTTTCCCAATAAATCCCA No data
Right 935724487 2:106011124-106011146 TCCACGAGCCTAATTTTTCATGG No data
935724484_935724487 1 Left 935724484 2:106011100-106011122 CCATTTTTCTCACCCTTCAAATT No data
Right 935724487 2:106011124-106011146 TCCACGAGCCTAATTTTTCATGG No data
935724483_935724487 2 Left 935724483 2:106011099-106011121 CCCATTTTTCTCACCCTTCAAAT No data
Right 935724487 2:106011124-106011146 TCCACGAGCCTAATTTTTCATGG No data
935724481_935724487 12 Left 935724481 2:106011089-106011111 CCCAATAAATCCCATTTTTCTCA No data
Right 935724487 2:106011124-106011146 TCCACGAGCCTAATTTTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935724487 Original CRISPR TCCACGAGCCTAATTTTTCA TGG Intergenic
No off target data available for this crispr