ID: 935724490

View in Genome Browser
Species Human (GRCh38)
Location 2:106011137-106011159
Sequence TTTTTCATGGTCATGTGACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935724483_935724490 15 Left 935724483 2:106011099-106011121 CCCATTTTTCTCACCCTTCAAAT No data
Right 935724490 2:106011137-106011159 TTTTTCATGGTCATGTGACAAGG No data
935724482_935724490 24 Left 935724482 2:106011090-106011112 CCAATAAATCCCATTTTTCTCAC 0: 10
1: 67
2: 63
3: 124
4: 487
Right 935724490 2:106011137-106011159 TTTTTCATGGTCATGTGACAAGG No data
935724486_935724490 1 Left 935724486 2:106011113-106011135 CCTTCAAATTGTCCACGAGCCTA No data
Right 935724490 2:106011137-106011159 TTTTTCATGGTCATGTGACAAGG No data
935724485_935724490 2 Left 935724485 2:106011112-106011134 CCCTTCAAATTGTCCACGAGCCT No data
Right 935724490 2:106011137-106011159 TTTTTCATGGTCATGTGACAAGG No data
935724481_935724490 25 Left 935724481 2:106011089-106011111 CCCAATAAATCCCATTTTTCTCA No data
Right 935724490 2:106011137-106011159 TTTTTCATGGTCATGTGACAAGG No data
935724484_935724490 14 Left 935724484 2:106011100-106011122 CCATTTTTCTCACCCTTCAAATT No data
Right 935724490 2:106011137-106011159 TTTTTCATGGTCATGTGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935724490 Original CRISPR TTTTTCATGGTCATGTGACA AGG Intergenic
No off target data available for this crispr