ID: 935726022

View in Genome Browser
Species Human (GRCh38)
Location 2:106024629-106024651
Sequence CTGAGGGTGTGGAGTCAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935726010_935726022 21 Left 935726010 2:106024585-106024607 CCTGTGAAATCAGGGGCCCCAGG No data
Right 935726022 2:106024629-106024651 CTGAGGGTGTGGAGTCAAGAGGG No data
935726013_935726022 5 Left 935726013 2:106024601-106024623 CCCCAGGAGAATCTAACAGGTGG No data
Right 935726022 2:106024629-106024651 CTGAGGGTGTGGAGTCAAGAGGG No data
935726007_935726022 29 Left 935726007 2:106024577-106024599 CCTTGGGGCCTGTGAAATCAGGG No data
Right 935726022 2:106024629-106024651 CTGAGGGTGTGGAGTCAAGAGGG No data
935726016_935726022 3 Left 935726016 2:106024603-106024625 CCAGGAGAATCTAACAGGTGGCT No data
Right 935726022 2:106024629-106024651 CTGAGGGTGTGGAGTCAAGAGGG No data
935726015_935726022 4 Left 935726015 2:106024602-106024624 CCCAGGAGAATCTAACAGGTGGC No data
Right 935726022 2:106024629-106024651 CTGAGGGTGTGGAGTCAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935726022 Original CRISPR CTGAGGGTGTGGAGTCAAGA GGG Intergenic
No off target data available for this crispr