ID: 935726197

View in Genome Browser
Species Human (GRCh38)
Location 2:106026158-106026180
Sequence GGCAGCTGGCCAATATCCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935726197_935726200 -6 Left 935726197 2:106026158-106026180 CCGTGGGATATTGGCCAGCTGCC No data
Right 935726200 2:106026175-106026197 GCTGCCTTCAAATATTTGACGGG No data
935726197_935726199 -7 Left 935726197 2:106026158-106026180 CCGTGGGATATTGGCCAGCTGCC No data
Right 935726199 2:106026174-106026196 AGCTGCCTTCAAATATTTGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935726197 Original CRISPR GGCAGCTGGCCAATATCCCA CGG (reversed) Intergenic
No off target data available for this crispr