ID: 935730364

View in Genome Browser
Species Human (GRCh38)
Location 2:106060050-106060072
Sequence CAGGGTTCTCCCTCTGTAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935730350_935730364 26 Left 935730350 2:106060001-106060023 CCTGTGGTTGCCGGCCCGTTGTT No data
Right 935730364 2:106060050-106060072 CAGGGTTCTCCCTCTGTAGTGGG No data
935730355_935730364 11 Left 935730355 2:106060016-106060038 CCGTTGTTTAGGCAGTTTTCGGG No data
Right 935730364 2:106060050-106060072 CAGGGTTCTCCCTCTGTAGTGGG No data
935730349_935730364 27 Left 935730349 2:106060000-106060022 CCCTGTGGTTGCCGGCCCGTTGT No data
Right 935730364 2:106060050-106060072 CAGGGTTCTCCCTCTGTAGTGGG No data
935730353_935730364 12 Left 935730353 2:106060015-106060037 CCCGTTGTTTAGGCAGTTTTCGG No data
Right 935730364 2:106060050-106060072 CAGGGTTCTCCCTCTGTAGTGGG No data
935730352_935730364 16 Left 935730352 2:106060011-106060033 CCGGCCCGTTGTTTAGGCAGTTT No data
Right 935730364 2:106060050-106060072 CAGGGTTCTCCCTCTGTAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935730364 Original CRISPR CAGGGTTCTCCCTCTGTAGT GGG Intergenic
No off target data available for this crispr