ID: 935730575

View in Genome Browser
Species Human (GRCh38)
Location 2:106062015-106062037
Sequence CCTTGGAGGCAGAGTCAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 370
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 335}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935730569_935730575 12 Left 935730569 2:106061980-106062002 CCCTCTCGGCTGTCGAATCTCTC 0: 1
1: 0
2: 0
3: 2
4: 49
Right 935730575 2:106062015-106062037 CCTTGGAGGCAGAGTCAAGATGG 0: 1
1: 0
2: 1
3: 33
4: 335
935730570_935730575 11 Left 935730570 2:106061981-106062003 CCTCTCGGCTGTCGAATCTCTCT 0: 1
1: 0
2: 0
3: 3
4: 39
Right 935730575 2:106062015-106062037 CCTTGGAGGCAGAGTCAAGATGG 0: 1
1: 0
2: 1
3: 33
4: 335

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935730575 Original CRISPR CCTTGGAGGCAGAGTCAAGA TGG Intergenic
900394232 1:2446567-2446589 CATTGGAGGCAGAGGGAGGAAGG + Intronic
900742489 1:4339231-4339253 GCTTGGAGGCTTAGGCAAGATGG + Intergenic
900822402 1:4899665-4899687 CCTGGGAGGCAGAGTGAGGAGGG - Intergenic
900913743 1:5620171-5620193 ACTTGAAGGCAGAAACAAGAAGG + Intergenic
901042996 1:6376818-6376840 CCTGGGAGGCAGAGCGAACATGG + Intronic
901254165 1:7806684-7806706 CTTAGGAGGCTGAGGCAAGAGGG + Intronic
901647552 1:10724747-10724769 CCTGGGAGGGAGAGGCAAGGCGG + Intronic
903094520 1:20957177-20957199 GCTTGAAGGCAGACTTAAGAGGG + Intronic
904377213 1:30089343-30089365 CCTTGGGGCCTGAGTCAAGGAGG + Intergenic
905763437 1:40580330-40580352 CTTGGGAGGCTGAGGCAAGAGGG + Intergenic
906613269 1:47218173-47218195 CCTCGAAGGCAGAGCCTAGAGGG + Exonic
907472071 1:54680413-54680435 AGCTGGAGGCAGAGTCAGGACGG - Intronic
907476807 1:54711249-54711271 CCTTGGAGGCTGTGTTAAGGAGG + Intronic
908197417 1:61758866-61758888 CTTTGGAGGCTGAGGCCAGAGGG - Intronic
908789096 1:67763638-67763660 CCCTGGAGGCTGAGGCAGGAGGG - Intronic
910188446 1:84570943-84570965 GCCTGGAGGCAGAGACAACATGG + Intronic
910377884 1:86593430-86593452 GCTTGGAGGTAGAAGCAAGATGG - Intergenic
911055907 1:93708371-93708393 CCTTGGAAACAAAGTTAAGATGG - Intronic
911504620 1:98733309-98733331 GCTAGGAGGCAGAGTCAGGAGGG - Intronic
912410584 1:109478237-109478259 AATTGGAGGCAGAGTGCAGAAGG - Intronic
912874117 1:113339185-113339207 CCTTGGAGGAAGACACAGGAGGG + Intergenic
913319701 1:117579531-117579553 CCTCAGAGGCAGAGTAAGGAAGG - Intergenic
914410540 1:147423215-147423237 CCTTGGGGGAGGAGCCAAGATGG + Intergenic
915579911 1:156807376-156807398 CCTAGGAGGCAGAGGGTAGAGGG - Intronic
916540979 1:165753701-165753723 CTTGGGAGGCTGAGACAAGAGGG + Intronic
916817921 1:168371534-168371556 CCATGGAGACAGAGTCCAGCTGG - Intergenic
918234018 1:182561177-182561199 CCTTGGGGGCAGAATGAAAAGGG + Intergenic
920306442 1:205021090-205021112 CCTGGGAGGCATAGGCAAGCCGG + Exonic
920668967 1:207988512-207988534 TGTTGGAGGCAGAATCAACAAGG + Intergenic
922042272 1:221908095-221908117 CCTTGGAGGCTGAGGCCGGAGGG + Intergenic
922504079 1:226116361-226116383 CCTTAGTGCCACAGTCAAGAAGG + Intergenic
924115797 1:240745055-240745077 GCTTGGAGGTTGAGTCAATATGG - Intergenic
1063058259 10:2525560-2525582 CCCTGGAGGCTAAGTCATGAAGG - Intergenic
1064126366 10:12664573-12664595 CCTTGGAGGTTGAGTCAAGAAGG - Intronic
1069809910 10:71150694-71150716 ACCTGAAGTCAGAGTCAAGAGGG + Intergenic
1070225275 10:74497721-74497743 CTTGGGAGGCAGAGACAGGATGG + Intronic
1071570706 10:86695291-86695313 CCTTGGAGGCAGAGCAGTGATGG - Intronic
1072277775 10:93839722-93839744 CCAGAGAGGCAGAGTCAAGAGGG + Intergenic
1074165679 10:110872079-110872101 CCTCGGAGGCAGCCGCAAGATGG + Intronic
1075259480 10:120950007-120950029 CCTTGGAAGGAAAGGCAAGAGGG + Intergenic
1076712567 10:132346598-132346620 CCCGGGAGGCGGAGCCAAGATGG + Intronic
1077191141 11:1256386-1256408 CCTTAGAGACAGAGTCAGGCAGG + Intronic
1077669987 11:4148333-4148355 CCTGGGAGGCTGAGGCAAGAGGG - Intergenic
1079307321 11:19334618-19334640 ACTTGGAGGCAGCATGAAGAGGG + Intergenic
1079981295 11:27154036-27154058 CCTGGGAGGCTGAGTGAAGCTGG + Intergenic
1080657793 11:34271373-34271395 CCCTGGAGCCAGAGTCTGGATGG - Intronic
1081406252 11:42701879-42701901 ACTTGGAAGGAGGGTCAAGAGGG + Intergenic
1081968378 11:47183055-47183077 CCTTCAAGGCAGAGTCACGGTGG - Exonic
1084090352 11:66875547-66875569 CCGAGGAGGAAGAGCCAAGAAGG + Intronic
1085267446 11:75245639-75245661 CCTTGAAGGAAGAGTCAGGAAGG + Intergenic
1085273755 11:75285316-75285338 CCTTGGGGGCAGAGTCCAGCTGG + Intronic
1085538542 11:77243980-77244002 CCTTGGTGAAAGAGTCAACATGG + Intronic
1085580413 11:77645107-77645129 GCTTGGAGTTAGAGGCAAGATGG + Intergenic
1085794320 11:79523598-79523620 ACTTGGACGCAGTGACAAGATGG + Intergenic
1086989683 11:93289280-93289302 TTTTGGAGGCAGAGTGAAGGAGG - Intergenic
1087012622 11:93528439-93528461 ACTTGGAGGCAGAGACGAGCAGG - Intronic
1088201451 11:107339739-107339761 CCTGGGAGGCAGAGTCTTCAGGG - Intronic
1089079697 11:115765425-115765447 AGTTGGAGGCAGCTTCAAGATGG - Intergenic
1089606542 11:119644730-119644752 CATTGTAGGCAGAGTGAGGAGGG + Intronic
1089919324 11:122193508-122193530 CCTTGGGGGCATACACAAGAAGG + Intergenic
1090726295 11:129530267-129530289 CCAAGGAGGCTGAGTCCAGATGG - Intergenic
1091446136 12:545202-545224 CCTGGGAGACAGTGTGAAGATGG - Intronic
1091697452 12:2637627-2637649 CCCTGGAGGCAGAATCTAGTGGG - Intronic
1092021113 12:5202915-5202937 CTTTGGTGGCAGATTAAAGATGG - Intergenic
1093498182 12:19780631-19780653 CCTAGGATGCAGTGTGAAGAAGG - Intergenic
1093543045 12:20310407-20310429 CTTGGGAGGCTGAGGCAAGAGGG + Intergenic
1095176474 12:39097703-39097725 TTTTGGAGGCTGAGTCAAGTAGG + Intergenic
1095203390 12:39411632-39411654 CTTGGGAGGCTGAGGCAAGAGGG - Intronic
1095417275 12:41990579-41990601 CCTGGGAGGCTGAGGCCAGAGGG - Intergenic
1095691673 12:45096282-45096304 CCTGGGAGGCGGAGGCAAGATGG + Intergenic
1095982990 12:47983304-47983326 CCTAGGAGGCAAGGGCAAGAGGG - Intronic
1096367154 12:51037796-51037818 CCTGGGAGGCTGAGGCAGGAGGG + Intergenic
1096922496 12:55102265-55102287 TCTTGGAGGAGGAGCCAAGATGG - Intergenic
1097268055 12:57756908-57756930 CCCTGGAGGAAGAGTGAGGAGGG - Exonic
1098850911 12:75594722-75594744 CCTTGGAAGCAGTGGCAATAAGG - Intergenic
1099172383 12:79380500-79380522 CTTGGGAGGCTGAGGCAAGAGGG - Intronic
1099252442 12:80272811-80272833 CATAGGAGGCAGAGACAAGAAGG + Intronic
1100712889 12:97276280-97276302 CCTTGGAGGCAGCGCCCAGTAGG - Intergenic
1101753426 12:107602086-107602108 CCTTGGAATCAGAGACAAAAAGG + Intronic
1101933169 12:109032194-109032216 CTTGGGAGGCTGAGTCAGGAGGG + Intronic
1102025303 12:109711230-109711252 GATTGGAGACAGTGTCAAGATGG - Intergenic
1102596647 12:113998043-113998065 CTTGGGAGGCAGAGGCAGGAGGG - Intergenic
1104294135 12:127496239-127496261 CCTGTGAGGAAGAGCCAAGAAGG - Intergenic
1107649185 13:42527213-42527235 TTTTGGAGGCAGAGTGAAAACGG + Intergenic
1112558197 13:100488528-100488550 CCTTGGAGGCTGAGGCTGGAGGG + Intronic
1113935702 13:113994552-113994574 TCTGGGAGGCCGAGGCAAGAAGG + Intronic
1113968026 13:114165663-114165685 CCTAAGAGGCAGAGTTTAGAAGG - Intergenic
1114304715 14:21412036-21412058 CCTGGGTGACAGAGTGAAGATGG + Intronic
1114409372 14:22486276-22486298 ACTTGGATGGACAGTCAAGATGG - Intergenic
1114651299 14:24286272-24286294 TGTAGGAGGCAGAGTCAACAGGG - Intergenic
1116649918 14:47576991-47577013 TTTGGGAGGCAGAGGCAAGAGGG - Intronic
1116696670 14:48187079-48187101 CATTGGAGGAGGAGCCAAGATGG + Intergenic
1118857875 14:69638046-69638068 TCTTGGAGGCATAGGCAAAAGGG - Intronic
1119312090 14:73656666-73656688 CATGGGAGGCTGAGGCAAGAGGG - Intronic
1119523294 14:75302099-75302121 CTTTGGAGGCCGAGACAGGAGGG + Intergenic
1121306277 14:92909671-92909693 CCTTGGAGGAAGAGGAAAGGAGG - Intergenic
1121777327 14:96599190-96599212 CTCTGAAGGCAGAGCCAAGAGGG + Intergenic
1122580573 14:102769148-102769170 CCTTCCAGTCAGAGCCAAGAGGG - Intergenic
1122913084 14:104843317-104843339 GCTTCGAGGAAGAGTCAAGCAGG + Intergenic
1123086888 14:105720986-105721008 CCCTGGAGGCCGATTCAGGATGG + Intergenic
1124322178 15:28722919-28722941 CATCGGTGGCAGAGTCAAAATGG - Intronic
1124475051 15:30025914-30025936 CCTTTCAGGCAGAGGAAAGATGG + Intergenic
1124523276 15:30424761-30424783 CATCGGTGGCAGAGTCAAAATGG - Intergenic
1124535390 15:30541455-30541477 CATCGGTGGCAGAGTCAAAATGG + Intergenic
1124763264 15:32466141-32466163 CATCGGTGGCAGAGTCAAAATGG - Intergenic
1124775362 15:32582918-32582940 CATCGGTGGCAGAGTCAAAATGG + Intergenic
1126503416 15:49374617-49374639 CCTGGGAGGCGGAGCCTAGATGG - Intronic
1129277889 15:74459414-74459436 CCTGGGAGGCTGAGGCAGGAAGG - Intronic
1129487399 15:75887842-75887864 CATTGGAGGCAAAATCAAAATGG + Intronic
1130504908 15:84530272-84530294 CATTGGAGGCAGAATCAAAATGG - Intergenic
1131502839 15:92986837-92986859 CCTGGGAGGCTGAGTGAAAAAGG - Intronic
1133824288 16:9263156-9263178 CTTTGGAGGCAGACGCAGGAGGG - Intergenic
1134459920 16:14421976-14421998 CTTGGGAGGCTGAGTGAAGAGGG - Intergenic
1135379705 16:21985220-21985242 CTTTGGAAGCAGAGGCCAGAGGG - Intronic
1136041600 16:27583855-27583877 CAAAGAAGGCAGAGTCAAGAGGG - Intronic
1136251359 16:29007603-29007625 CCTGGGAGGCGGAGCCTAGATGG + Intergenic
1138200916 16:55087756-55087778 CCTGGGAGGCAGACTCAAGGTGG - Intergenic
1139789924 16:69425333-69425355 CAGTGGAGGCATAATCAAGATGG - Intronic
1142212506 16:88815170-88815192 GCTGAGAGGCCGAGTCAAGAGGG - Intronic
1142798304 17:2326742-2326764 CTTGGGAGGCTGAGGCAAGAGGG - Intronic
1144196737 17:12901888-12901910 CTTTGGAGGAAGAGTCAGCAGGG - Intronic
1146320577 17:31843418-31843440 ACTAGGAGGCAGAATCCAGATGG + Intergenic
1146323279 17:31863808-31863830 CCCTGGAGGCTGAGGCAGGAGGG - Intronic
1146652433 17:34614906-34614928 CCATGGGAGCAGAGTCTAGAGGG + Intronic
1147252912 17:39164440-39164462 ACTAGGAGCCAGAGGCAAGAAGG + Intronic
1147365181 17:39954420-39954442 CCTTGGAGGAAGGGACAATAGGG - Intergenic
1148161783 17:45454271-45454293 TCCTGGAGGCAGAGGCAAAAAGG + Exonic
1148435591 17:47681938-47681960 CCTGGGAGGCTGAGGCAGGAGGG - Intronic
1149040376 17:52181521-52181543 GCATGGAGGCAGAGGCAAGATGG + Intergenic
1149229813 17:54519638-54519660 CATAGGAGGCAGGGCCAAGAAGG - Intergenic
1149769185 17:59306605-59306627 CTTAGGAGGCAGAGACAGGAGGG + Intergenic
1149955292 17:61042780-61042802 CCTGGGAGGCTGAGGCAGGAGGG + Intronic
1150389530 17:64782191-64782213 CCCAGGAGGTGGAGTCAAGAGGG - Intergenic
1150393017 17:64800916-64800938 TCCTGGAGGCAGAGGCAAAAAGG + Intergenic
1150976917 17:70097869-70097891 CCTAGGAAACAGATTCAAGAGGG - Intronic
1151407231 17:73896505-73896527 CCCTGGAGCCAGAGGCAAGCTGG + Intergenic
1151517785 17:74607568-74607590 CCATGGAGGCAGAGCCATGGAGG + Intergenic
1151740542 17:75979157-75979179 CCTAGGAGGCAGCCTCAGGACGG + Exonic
1151929940 17:77225947-77225969 CCTTGGAGTCAGAGCCACGAGGG + Intergenic
1152003756 17:77664098-77664120 CTTTGGATGAGGAGTCAAGATGG + Intergenic
1154005184 18:10521277-10521299 TCTGGGAGGCTGAGGCAAGAGGG + Intergenic
1154124842 18:11681914-11681936 CCCAGGAGGCTGAGGCAAGAGGG + Intergenic
1154471769 18:14710090-14710112 CTTAGGAGGCTGAGGCAAGAGGG + Intergenic
1155181396 18:23351297-23351319 CTTGGGAGGCTGAGTCAGGAGGG + Intronic
1155264429 18:24077132-24077154 GCTTGGAGGCAGAGTGAAGCAGG - Intronic
1155492175 18:26410202-26410224 CCTGAGAGGCTGAGTCAGGAGGG - Intergenic
1155643208 18:28045171-28045193 CCTTAGAGGTAAAGTCTAGAGGG - Intronic
1158064495 18:53389580-53389602 CTCTGGAGGAAGTGTCAAGAAGG + Intronic
1158932684 18:62336455-62336477 GCATGGAGGCAGAGCCTAGAGGG + Intronic
1159190740 18:65038611-65038633 CCCTTGAGGCAGACACAAGAGGG + Intergenic
1160879334 19:1312473-1312495 CCTGGGAGGCAGGGACAAGCTGG - Intergenic
1161414871 19:4140358-4140380 CCTGGGAGGCGGAGTTGAGATGG + Intergenic
1161933071 19:7354065-7354087 CTTTGGAGGCTGAGCCAGGAGGG + Intronic
1162042175 19:7977675-7977697 CCTTGGTGGCAGAGTGGAGAAGG - Intronic
1164260534 19:23565211-23565233 CCTTGCAGGAAGGGTCAGGAAGG + Intronic
1164771590 19:30813739-30813761 ACTGGGAGGCAGTGGCAAGAGGG + Intergenic
1166103931 19:40588440-40588462 TTTTGGAGGCAGAGGCAACAGGG + Intronic
1166126934 19:40720577-40720599 CCATGGAGGCAGATTCTGGAAGG - Intronic
1166348367 19:42180834-42180856 CTTGGGAGGCTGAGGCAAGAGGG - Intronic
1166760044 19:45218469-45218491 CCTTGGACTCACAGTCCAGAAGG + Intronic
1166784923 19:45361999-45362021 CCCAGGAGGCGGAGTCGAGATGG - Intronic
1167455144 19:49593878-49593900 CCTTGGAGGCAAAGGCAAGGTGG - Intronic
1168584989 19:57584570-57584592 TCTTGGAGACACAGTGAAGAAGG + Intronic
924960931 2:33849-33871 CCGTGCAGGCAGAGGCAGGAAGG - Intergenic
925428864 2:3774000-3774022 CCTTGGAGGCACAGTGCAGGGGG - Intronic
926888815 2:17621733-17621755 CCCAGAAGGCAGAGACAAGAGGG - Intronic
928767079 2:34660154-34660176 TCTGGGAGGCAGAGTTCAGATGG + Intergenic
929593678 2:43162506-43162528 CCTTGGGGGCAGTGGCCAGAGGG + Intergenic
929600601 2:43201907-43201929 CCTTGGGGAGAGGGTCAAGAGGG + Intergenic
930651144 2:53966174-53966196 ACTTGGAGGCAGAGACATGAGGG + Intronic
931180834 2:59898877-59898899 CCTTGGAGGTAGAGGCAATCAGG + Intergenic
931728980 2:65136358-65136380 CCTGGGAGGCTGAGGCAGGAGGG + Intergenic
931940261 2:67244340-67244362 CTTTAGAGGCAGAGTCAACAGGG - Intergenic
932292724 2:70596169-70596191 CATTGGAGGCATAGACATGAAGG - Intergenic
932471909 2:71964847-71964869 GGTGGGAGGCAGAGTCATGATGG - Intergenic
933650540 2:84846769-84846791 CCTTGGAGAAAGACCCAAGACGG + Intronic
934089990 2:88542850-88542872 CCTGGGAGGCAGTGTCAGGGTGG + Intergenic
934122549 2:88854149-88854171 CCAAGGAGGCAGAGACCAGAGGG - Intergenic
935296109 2:101651048-101651070 TCTTGGAGTCAGATTGAAGAAGG - Intergenic
935730575 2:106062015-106062037 CCTTGGAGGCAGAGTCAAGATGG + Intergenic
936927713 2:117754718-117754740 CCTTGGAGGCAAAGGCAATTTGG + Intergenic
940592460 2:155747808-155747830 AAGTTGAGGCAGAGTCAAGATGG + Intergenic
941207194 2:162588896-162588918 CATTGGAGGGAGAGGAAAGAGGG - Intronic
942082808 2:172417245-172417267 TGTTTGAGGCAGATTCAAGATGG - Intergenic
942085198 2:172437106-172437128 CCTTGGAGGCAGATTGTATAGGG + Intronic
942483681 2:176417126-176417148 ACTAGGAGGTAGAGTAAAGAAGG + Intergenic
943074001 2:183172938-183172960 CCTTGGGGGTTGGGTCAAGATGG - Intergenic
943934913 2:193903871-193903893 CCTTGGAGGTGGAGCCAAGATGG + Intergenic
945081083 2:206086276-206086298 TCTTGGAGGCAGAGCAAAGGGGG + Intronic
945184146 2:207122682-207122704 CTTTGGAGGCACAGCCCAGAAGG + Intronic
945723260 2:213445552-213445574 CTTTGGAGGCTGAGGCAGGAGGG + Intronic
945991707 2:216401033-216401055 CTTAGGAGGCTGAGTCAAGAGGG - Intergenic
946771711 2:223095673-223095695 CTTCGGATGCAAAGTCAAGATGG - Intronic
947267098 2:228294949-228294971 ACCAGGAGGGAGAGTCAAGATGG + Intergenic
948077785 2:235179836-235179858 CCCTGGAGGCAGGGGTAAGACGG + Intergenic
948427455 2:237896751-237896773 CTTGGGAGGCTGAGTCAAGAGGG - Intronic
948685595 2:239667780-239667802 CCTTGGAGGAGGAGGCATGAGGG - Intergenic
1168838361 20:892870-892892 CCTTGAGGGCAGTGTCAAGGAGG - Intronic
1168978970 20:1988883-1988905 CCAGGGAGGCAGAGCCAACAAGG - Intronic
1169182416 20:3581142-3581164 CTTGGGAGGCTGAGGCAAGAGGG + Intronic
1172337080 20:34125858-34125880 CTTAGGAGGCTGAGTCAGGAGGG + Intergenic
1172753458 20:37267492-37267514 ACTTGGAGGCAGAGGCAGGCAGG + Intergenic
1172960335 20:38794616-38794638 CTTGGGAGGCTGAGGCAAGAAGG + Intergenic
1173936882 20:46874385-46874407 CCATGGGGTCAGAGTCAACAAGG + Intergenic
1174675776 20:52353106-52353128 TCTTGTAGGCAGAATTAAGATGG + Intergenic
1174852778 20:54011792-54011814 CCTGGGTGGCTGAGCCAAGATGG + Intronic
1175263618 20:57689713-57689735 CCTGGGAGGCAGATTCAGGGCGG - Intronic
1176342358 21:5710263-5710285 CCCTGGAGGAAGGGTCAACAGGG - Intergenic
1176474612 21:7142415-7142437 CCCTGGAGGAAGGGTCAACAGGG - Intergenic
1176502469 21:7614193-7614215 CCCTGGAGGAAGGGTCAACAGGG + Intergenic
1176536679 21:8108332-8108354 CCCTGGAGGAAGGGTCAACAGGG - Intergenic
1177705991 21:24705468-24705490 CCATGGAAGCAGAGTGGAGAGGG + Intergenic
1178305055 21:31484451-31484473 CCCCGGAGGCAGAGGCAAGCTGG - Intronic
1178341424 21:31788570-31788592 CTTTGGAGGCTGAGACAAGAGGG + Intergenic
1178824973 21:36007155-36007177 CTCTGGAGGCTGAGGCAAGAGGG + Intergenic
1181371683 22:22424083-22424105 CCTAGGAGGCTGAGGCAGGAGGG + Intergenic
1181812326 22:25411203-25411225 CCTTGGACGCAGAGTCCACCTGG - Intergenic
1183319438 22:37156106-37156128 CCTGGGAGGCGGAGTGGAGAGGG - Intronic
1184245562 22:43234220-43234242 CAACTGAGGCAGAGTCAAGATGG - Intronic
1185045256 22:48525459-48525481 CACTGGAAGCAGAGTCCAGAAGG - Intronic
1203241626 22_KI270733v1_random:24743-24765 CCCTGGAGGAAGGGTCAACAGGG - Intergenic
949990741 3:9577063-9577085 CCATTCAGGCAGGGTCAAGATGG + Intergenic
950581770 3:13866974-13866996 GTTTGGAGGTAGAGTCAAAATGG + Intronic
950723343 3:14900126-14900148 CCTTGGAGACAGACACAACAAGG - Intronic
950814698 3:15688363-15688385 CTTGGGAGGCTGAGGCAAGAGGG - Intronic
951303475 3:21027807-21027829 CCCTGGTGGTAGAGTTAAGAAGG - Intergenic
951823967 3:26846516-26846538 CTTTGGTGGCAGAGTAAAGAGGG - Intergenic
952547287 3:34433867-34433889 CCTTGGGGGAGGAGCCAAGATGG - Intergenic
953443565 3:42941783-42941805 CCTGGGAAGAAGAGTCAGGATGG - Intronic
954081827 3:48216745-48216767 CTTTGGAGGCATTGTCAAGCAGG + Intergenic
954174665 3:48834616-48834638 CTTGGGAGGCTGAGGCAAGAGGG + Intronic
954601562 3:51874560-51874582 ACTTGAAGTCAGAGTAAAGAGGG - Intronic
955482535 3:59404186-59404208 CCTTATAGGCAGAGGCATGAGGG - Intergenic
957673038 3:83329738-83329760 CCTTGGAGTCAGAGAAAAAAGGG + Intergenic
960440217 3:117677753-117677775 CCTGGGAGGCTGAGGCAGGAGGG - Intergenic
962867771 3:139461837-139461859 CCTGGCAGGCAGAGGGAAGAGGG - Intronic
963037560 3:141045748-141045770 CCTGGGAGGAAGCTTCAAGATGG - Intergenic
963590692 3:147254349-147254371 CCTGGAAGTCAGAGTCAGGAGGG - Intergenic
963829639 3:149993005-149993027 CCTTGGTGGCAGATTTAAGGAGG - Intronic
964580327 3:158227293-158227315 TCTTGGGGGCAGAGGGAAGAGGG - Intronic
966821796 3:183930637-183930659 CAATGGAGGCAGAGGCCAGAGGG + Intronic
967180583 3:186899713-186899735 CTCTGGAGGCTGAGGCAAGAGGG - Intergenic
967303939 3:188042728-188042750 AGTTGAAGGCAGAGTCAGGATGG - Intergenic
968276992 3:197447394-197447416 CCCTTGTGGCAGAGACAAGAAGG + Intergenic
968404022 4:323858-323880 CCTGGGAGGCTGAGGCAGGAGGG + Intergenic
969979736 4:11142291-11142313 CTTTGGAGGCTGAGGCAGGAGGG + Intergenic
970151721 4:13097106-13097128 TAATGGAGGCAGAGTCAAGCAGG - Intergenic
977095291 4:92734885-92734907 ACTTGGAGGCTGAGTTGAGAGGG - Intronic
977319168 4:95489376-95489398 CCTGGGAGGCAGAGAGAAGTGGG + Intronic
978105127 4:104892940-104892962 CCTCTGAGGCAGGTTCAAGATGG - Intergenic
978659032 4:111100758-111100780 TCTTGGAGGTGGAGCCAAGATGG - Intergenic
978736120 4:112086460-112086482 TCTTGGAGGAGGAGCCAAGATGG + Intergenic
979434251 4:120670493-120670515 CCTTGGAGGAAGTGGGAAGAAGG + Intergenic
980467224 4:133201934-133201956 CTTTGGGAGCAGAGTGAAGAAGG + Intronic
980557943 4:134433167-134433189 CCTTGTAGAATGAGTCAAGAAGG - Intergenic
981014448 4:139959326-139959348 CCATGGATGCAGAATCAAGACGG - Intronic
981478818 4:145214683-145214705 CTTGGGAGGCTGAGGCAAGAGGG - Intergenic
981520208 4:145652975-145652997 CCTGGGAGGCTGAGGCAGGAGGG - Intronic
981679640 4:147381835-147381857 GCGTGGAGGAAGAATCAAGAGGG - Intergenic
981974228 4:150704104-150704126 CCTTGGAGGCTGAGGTGAGAGGG + Intronic
982217125 4:153092075-153092097 CCGTGGAGGCAGAGACTGGAGGG - Intergenic
982781380 4:159494582-159494604 CTTTGGAGGCTGAGGCAGGAGGG + Intergenic
986117830 5:4797604-4797626 CCTAGGAGGGAGATTCATGAAGG - Intergenic
987169149 5:15235270-15235292 TCTTGGAGGCAGAGAGAAGATGG + Intergenic
987474400 5:18373091-18373113 CTTTGGAAGCAGAATCAGGAGGG + Intergenic
988506692 5:31829938-31829960 CTCTGGAGGCTGAGGCAAGAGGG + Intronic
990315406 5:54578445-54578467 CCTTGGAGGCAGAGCCACTAAGG - Intergenic
992703147 5:79361156-79361178 CCTAGCAGCCAGAGTGAAGAGGG + Intergenic
993135485 5:83956219-83956241 TCTTGGATGCAGGGTAAAGAAGG - Intronic
995844301 5:116477567-116477589 CCCTGGAGAGAGAGACAAGAAGG - Intronic
997234763 5:132266390-132266412 CCTGGGAGCCAGGATCAAGAGGG - Intronic
998382352 5:141734920-141734942 CCTTGGAGGTGGAGCCAGGATGG + Intergenic
1000828984 5:166080508-166080530 TTTTGGAGGCAGAGGCAGGAAGG - Intergenic
1001190514 5:169626360-169626382 CTTGGGAGGCTGAGGCAAGAGGG + Intergenic
1001776274 5:174331387-174331409 CTTGGGAGGCTGAGTCAGGAGGG + Intergenic
1001825818 5:174744132-174744154 CCTAGGAGGCTGAGGCAGGAGGG + Intergenic
1003210576 6:4061077-4061099 CCCTGCAGGCAGGCTCAAGAAGG - Exonic
1003673776 6:8183708-8183730 ACTTAGAGGCAGAGGGAAGATGG + Intergenic
1005367287 6:25091353-25091375 CATTGGAGACAGTGTCAAGATGG - Intergenic
1007000739 6:38309986-38310008 CTTTGGAGGCAGAGAGAAAAAGG + Intronic
1007260798 6:40561754-40561776 CCCTGGTGGGAGAGTCAGGAAGG + Intronic
1007306573 6:40911380-40911402 GCTTGGAGGAAGGGCCAAGAGGG - Intergenic
1007492778 6:42236836-42236858 CCTTGGAGAGAGACTAAAGAAGG + Intronic
1008875276 6:56319263-56319285 TCTGGTAGGCAGAGTCAAGAGGG + Intronic
1010230864 6:73534032-73534054 CTTCGGAGGCCGAGGCAAGAAGG + Intergenic
1012512741 6:100023037-100023059 CCTGGGAGGCTGAGTGAAGAGGG + Intergenic
1012858580 6:104531816-104531838 CCTTGGGAGCAGAGTCATAAGGG - Intergenic
1013751161 6:113408159-113408181 CCTTGGAAGCATAGTGTAGAGGG + Intergenic
1015094851 6:129403018-129403040 CATAGGAGGGAGAGTAAAGAGGG + Intronic
1016056374 6:139581961-139581983 CCTAGGTGACAGAGTGAAGATGG - Intergenic
1018365823 6:163118744-163118766 CCTTGAAGGCAGATTGAACATGG - Intronic
1018493846 6:164327246-164327268 CCTTGTGAGCAGAGTCACGATGG + Intergenic
1019337252 7:491282-491304 CCTAGAAGTCAGAGTCAAGGAGG + Intergenic
1019361546 7:607352-607374 CCTCGGAGCCAAAGTCCAGAGGG - Intronic
1019378221 7:707595-707617 ACTTGGAGGCAGGGTCTTGACGG + Intronic
1019499841 7:1359310-1359332 CCTAGGAGCCAGAGACAAGGTGG - Intergenic
1022014653 7:26338987-26339009 CCTTGGAGCCAGAGACTACATGG + Intronic
1022351525 7:29570710-29570732 CCTTGGAGGCAGGGTAAGAATGG - Intergenic
1022665215 7:32404459-32404481 CCCAGGAGGCAGAGGCAGGAGGG - Intergenic
1023282315 7:38583781-38583803 CCCTGGAGGCAGAGTGAGGGGGG + Intronic
1023623481 7:42095142-42095164 ACTTGGAGGCAAGGTCAAGTTGG - Intronic
1026221530 7:68402139-68402161 CCATGCAGGCAGGGTCCAGAGGG + Intergenic
1026326860 7:69318044-69318066 CTTGGGAGGCTGAGGCAAGAGGG - Intergenic
1026865772 7:73823131-73823153 AATTGGAGGGAGAGTCAGGAGGG - Intronic
1027742017 7:82020334-82020356 ACTAAGTGGCAGAGTCAAGATGG - Intronic
1028065150 7:86375394-86375416 CCTTGGGGGTGGAGCCAAGATGG + Intergenic
1028091991 7:86714224-86714246 CCTTAGAGGCAGAGCCAAAATGG - Intronic
1029636209 7:101785938-101785960 CTTGGGAGGCTGAGACAAGAGGG + Intergenic
1030491066 7:110235393-110235415 CCTTGGAGGAAGAGTGATGCAGG - Intergenic
1031426343 7:121610120-121610142 CCTTAGAGGAAGAGTTGAGAAGG - Intergenic
1032311613 7:130792724-130792746 CCTTGGAGACACAGTAAAGGAGG + Intergenic
1033242499 7:139691722-139691744 CCCTGGACGCAGAGCCAGGAAGG - Intronic
1033355704 7:140597766-140597788 CCTTGGAGGAAGAGCCAGAAGGG + Intronic
1033999819 7:147399444-147399466 TTTTGGAGGCAGAGTCAGTAGGG + Intronic
1034311441 7:150092344-150092366 CCTTGGAGGCAGAACAAAGCTGG - Intergenic
1034474682 7:151275596-151275618 CATTGGAGGCAAAGGCCAGAGGG + Intronic
1034795415 7:154008310-154008332 CCTTGGAGGCAGAACAAAGCTGG + Intronic
1035287826 7:157817356-157817378 GCTGGGAGGCACAGTCAAAAGGG - Intronic
1035459625 7:159030935-159030957 CCTTGGGGGCAGAGGCTGGAGGG + Intronic
1035935442 8:3832177-3832199 CCGTGGAGGCTGAGTCACGTGGG + Intronic
1036696817 8:10980200-10980222 CCTTCCAGGCAGAGGCAGGAAGG + Intronic
1036739509 8:11347874-11347896 CCGTGGTCGCAGAGTCAGGAGGG + Intergenic
1038928054 8:32162557-32162579 ACTTGGAGGCATAGTAGAGATGG + Intronic
1039209085 8:35191210-35191232 ACTTGGAGGCTGAGAAAAGAGGG - Intergenic
1039495639 8:37978081-37978103 CCTAGGAGGCTGAGGCAGGAGGG - Intergenic
1039568491 8:38567537-38567559 CATTGGAGGCAGGGACCAGATGG - Intergenic
1041308564 8:56489749-56489771 CTTGGGAGGCTGAGGCAAGAGGG + Intergenic
1041517408 8:58715694-58715716 CCTTGGAGGTAGACTGTAGACGG + Intergenic
1042487073 8:69357416-69357438 CCTGGGAGGAGGAGCCAAGATGG - Intergenic
1043552245 8:81387310-81387332 CCTTGGAGACTGATTCAAAATGG - Intergenic
1044707601 8:95024131-95024153 CCTTGGAGGCCCAGACAAGCAGG + Intronic
1047223416 8:122937222-122937244 TCATGGAAGCAGAGTCAGGAAGG + Intronic
1047550755 8:125870049-125870071 TCTTGGAGTCAGTGTCCAGATGG + Intergenic
1049660458 8:143817517-143817539 CCTTGGAGACTGATTCAAGGTGG - Intronic
1049672950 8:143877859-143877881 CGTGGGAGGCAGAGGCAGGAAGG - Intronic
1051193303 9:14536694-14536716 CCATGAAGGCAGGGACAAGAAGG + Intergenic
1051209279 9:14724511-14724533 TTTGGGAGGCAGAGGCAAGATGG - Intergenic
1052513374 9:29450388-29450410 CCTTAGAGGAGGAGCCAAGATGG + Intergenic
1056108891 9:83375059-83375081 CCCTGGAGTCAGAGACAAGTTGG - Intronic
1056232904 9:84565163-84565185 ACTTGGAGGCTGAGGCAGGAGGG + Intergenic
1056512096 9:87315973-87315995 CCATGGAGGCAGAGAGAAAAGGG + Intergenic
1056748206 9:89323501-89323523 GCCTGGAGGGAGAGGCAAGAAGG + Intronic
1057939311 9:99266937-99266959 GCTAGGAGGCAGAGGAAAGAAGG - Intergenic
1060342963 9:122792976-122792998 CCTTGAAGGGAGAGTGTAGAGGG - Intergenic
1060878756 9:127102958-127102980 CCTTGAAGGCTGACTCAGGATGG + Intronic
1061884495 9:133584788-133584810 CCTCGGAGGCAGAGCCATGCGGG + Intronic
1061966969 9:134020447-134020469 CCTGGGAGGCTGAGGCAGGAGGG - Intergenic
1203457950 Un_GL000220v1:7818-7840 CCCTGGAGGAAGGGTCAACAGGG - Intergenic
1185462335 X:339210-339232 CCGTGCAGGCAGAGGCCAGAGGG + Intronic
1185802990 X:3030161-3030183 GCTTGGAAGCAGAGGCAGGAAGG + Intronic
1187424206 X:19162513-19162535 CTTTGGAGGCCGAGGCAGGAGGG - Intergenic
1188042610 X:25387250-25387272 GCTTGGAAGAAGAGTCAAGAGGG + Intergenic
1189709599 X:43795813-43795835 CCTTGGAGACCGAGTGAAGCTGG - Exonic
1193051426 X:77103532-77103554 ACTTGGAGGTGGAGCCAAGATGG - Intergenic
1193698894 X:84740424-84740446 CCTGGGAGGCAGGGTCAATGTGG - Intergenic
1194863110 X:99029137-99029159 CCTTAGAGGCTGAGGCACGAGGG - Intergenic
1195322270 X:103729421-103729443 CCTTTGAGGAAGAGTCAGGCAGG - Intergenic
1196862158 X:120038717-120038739 GCTTGGAGGCAAAGGCAAGTGGG + Intergenic
1196880944 X:120197627-120197649 GCTTGGAGGCAAAGGCAAGTGGG - Intergenic
1197101350 X:122659469-122659491 CCTTGCAGGCAGAGGCAAAAAGG - Intergenic
1198060670 X:133042642-133042664 CCTTGGAGGAGGGGCCAAGATGG - Intronic
1198485908 X:137087334-137087356 CACTGGAGGCTGAGGCAAGAAGG - Intergenic
1199240955 X:145546702-145546724 GGTTGGAGGCAGGGCCAAGAGGG + Intergenic
1199639323 X:149845087-149845109 TCTTTGAAGCAGAGTCAAAAAGG - Intergenic
1200855441 Y:7932932-7932954 CTTTGAAGGCAGAGCCACGATGG + Intergenic
1202263917 Y:22998311-22998333 CTTTGAAGGCAGAGCCACGATGG - Exonic
1202365038 Y:24154340-24154362 CATTGGAGGCAGAATCAAAATGG + Intergenic
1202416908 Y:24632053-24632075 CTTTGAAGGCAGAGCCACGATGG - Exonic
1202453879 Y:25038033-25038055 CTTTGAAGGCAGAGCCACGATGG + Exonic
1202505743 Y:25515782-25515804 CATTGGAGGCAGAATCAAAATGG - Intergenic