ID: 935731849

View in Genome Browser
Species Human (GRCh38)
Location 2:106070793-106070815
Sequence CCTTCCATGGACAGGCTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 1, 2: 1, 3: 20, 4: 215}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935731849_935731855 6 Left 935731849 2:106070793-106070815 CCCTGGAGCCTGTCCATGGAAGG 0: 1
1: 1
2: 1
3: 20
4: 215
Right 935731855 2:106070822-106070844 TAAGAACCCTGCTGAGAAAGTGG 0: 1
1: 0
2: 2
3: 19
4: 192
935731849_935731859 28 Left 935731849 2:106070793-106070815 CCCTGGAGCCTGTCCATGGAAGG 0: 1
1: 1
2: 1
3: 20
4: 215
Right 935731859 2:106070844-106070866 GTCACCATTACCTCCATCCTGGG 0: 1
1: 0
2: 1
3: 10
4: 196
935731849_935731858 27 Left 935731849 2:106070793-106070815 CCCTGGAGCCTGTCCATGGAAGG 0: 1
1: 1
2: 1
3: 20
4: 215
Right 935731858 2:106070843-106070865 GGTCACCATTACCTCCATCCTGG 0: 1
1: 0
2: 0
3: 13
4: 141
935731849_935731860 29 Left 935731849 2:106070793-106070815 CCCTGGAGCCTGTCCATGGAAGG 0: 1
1: 1
2: 1
3: 20
4: 215
Right 935731860 2:106070845-106070867 TCACCATTACCTCCATCCTGGGG 0: 1
1: 0
2: 0
3: 20
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935731849 Original CRISPR CCTTCCATGGACAGGCTCCA GGG (reversed) Intronic
900903673 1:5535395-5535417 CCTTCCATTGACAGAAACCAAGG - Intergenic
901206613 1:7501172-7501194 CCTTCCAGGGAGAGCCTCCCTGG - Intronic
901215326 1:7551731-7551753 AGTGCCAGGGACAGGCTCCAAGG - Intronic
903339268 1:22643878-22643900 CCATCCATGGTGAGGCTCCTGGG + Intronic
903369970 1:22829229-22829251 CCTTCCCTGCCAAGGCTCCAGGG - Intronic
903775052 1:25787643-25787665 ACTTCCAAGGACAGGCCCCCAGG - Intergenic
904634324 1:31867919-31867941 TCTTCCTTGCACAGTCTCCATGG + Intergenic
907285373 1:53376427-53376449 CCTTCCATGGACAGGGGTGAAGG + Intergenic
911497859 1:98652336-98652358 GCTTCCATGGACAGACTCACAGG - Intergenic
912386277 1:109272689-109272711 CCTTCCAGGAACAGGCTGCCTGG - Exonic
914839523 1:151236715-151236737 CCATCCAGGGAGAGGCTCGACGG + Exonic
916522755 1:165579972-165579994 GCTTCCATGGTCATGCTCCCGGG - Intergenic
919453840 1:197800788-197800810 GCTCCCAGGGGCAGGCTCCAGGG - Intergenic
922125636 1:222719338-222719360 CATTGCAAGGACAGGTTCCAAGG + Exonic
1063537685 10:6901012-6901034 CCTTCCATGGAGAGGAGACATGG + Intergenic
1067055280 10:43046319-43046341 CCTTCCTTGGACCGGGTGCAGGG + Intergenic
1067695695 10:48534157-48534179 CCTTCCATGAACAGCATCCGTGG - Intronic
1069592783 10:69652365-69652387 GCTCCCAGGGGCAGGCTCCAGGG - Intergenic
1069748993 10:70733828-70733850 CCTTCCCGGGGCAGGCTCCTGGG + Intronic
1069772926 10:70910886-70910908 CTCTCCAGGGACAGGCCCCAAGG - Intergenic
1069898138 10:71691611-71691633 CCTTCCATGTTGTGGCTCCAAGG + Intronic
1070659363 10:78293630-78293652 CCTTTCATGGACTGTCTCCAGGG + Intergenic
1071489296 10:86125092-86125114 ACTGGCATGGACAGGCTCCCTGG + Intronic
1072290491 10:93960437-93960459 CCATCCAGGGAGAGGCTCGACGG - Intergenic
1072443710 10:95479701-95479723 TCATCCATGGACAGGCTGTAAGG + Intronic
1073186648 10:101619022-101619044 CCTTCCTTGGCTAGGCCCCAGGG - Intronic
1073217777 10:101846058-101846080 CCTCCCTTGGATAGCCTCCATGG - Exonic
1075168234 10:120088645-120088667 TCTTCTATGGACAGGGTCCATGG - Intergenic
1076649529 10:131978441-131978463 CCCTCCAGTGACAGACTCCAGGG + Intronic
1076715924 10:132363680-132363702 CCTTCCAAGCTCAGGCCCCACGG - Intronic
1076738575 10:132469436-132469458 CCCTCCTGGGACAGGCCCCAGGG - Intergenic
1079689878 11:23405615-23405637 CCTACCATGGCCAGGCTCCCAGG - Intergenic
1080770003 11:35331909-35331931 CCTAACATGGACAGGGCCCAGGG - Intronic
1089731246 11:120520457-120520479 CCTTCCCTGGATGGCCTCCATGG - Intronic
1090282603 11:125469067-125469089 CCTTCCCTGAGTAGGCTCCAAGG + Intronic
1091005284 11:131947618-131947640 AATTCCATGGACAGACCCCAGGG - Intronic
1091638444 12:2215642-2215664 CCCTTCAGGGACAGGCTCCAGGG + Intronic
1091805518 12:3353326-3353348 GCTTCCATGGACTGACTGCAGGG - Intergenic
1092171050 12:6374322-6374344 CCTTCCAGGCGCAGGCACCAGGG + Intronic
1092265058 12:6974467-6974489 CCTTCCATACAGAGGCTCAAAGG - Intronic
1093780811 12:23135341-23135363 CATTGCATGGACATGCTCCAGGG + Intergenic
1096152850 12:49325489-49325511 CTTTCCTTGCAGAGGCTCCAGGG + Exonic
1098267630 12:68738483-68738505 CCTTACATAGATAGGTTCCATGG + Intronic
1098696625 12:73565932-73565954 CCTTTCAGGCACAGACTCCATGG - Intergenic
1101494632 12:105242021-105242043 GTTTCCATGGACTGGCTACAGGG - Intronic
1101830026 12:108249778-108249800 CTTTGCATGGCCAGGTTCCAAGG - Exonic
1102242611 12:111334515-111334537 CTCTCCAGGGACAGGCTCAACGG - Exonic
1102979800 12:117232271-117232293 CCTTCCATGCCCAGAATCCAGGG + Intronic
1103561381 12:121794786-121794808 TCTGCCGTGGACCGGCTCCAGGG - Intronic
1103750854 12:123159448-123159470 CCTGCCATGGCCAGGCGCAATGG - Intronic
1110394125 13:75010128-75010150 CACTCCATGTAGAGGCTCCAGGG - Intergenic
1112388856 13:98964477-98964499 CCATCCATGCACATGCTCCCTGG - Intronic
1113855904 13:113445404-113445426 CCTGGCATGGCCAGGCACCAGGG - Intronic
1114061146 14:19016637-19016659 CCTGGCATGCACAGGCCCCAGGG - Intergenic
1114473082 14:22977183-22977205 CCTTCCAGGGACAGACTCCATGG + Intronic
1114554368 14:23553117-23553139 ACCTCCATGGTCTGGCTCCAGGG + Intronic
1116861878 14:50001789-50001811 CCTTCCACGGAGAGGCTGCCGGG + Intronic
1116993147 14:51296710-51296732 CGTTCCATGGATAGGCTACAGGG + Intergenic
1119426060 14:74535402-74535424 CCTGCCTGGGACAGGCTCCTGGG - Intronic
1120525420 14:85571496-85571518 CCTTCGATTGACATGCTCAAAGG + Intronic
1121563016 14:94888055-94888077 CCTTCCAAGGACAAGTTCCAAGG + Intergenic
1121877420 14:97466078-97466100 CCTTCGGTGGACAGCCTCAAAGG + Intergenic
1122480309 14:102042897-102042919 CCTTCCATGGCCGGGCACCGTGG + Intronic
1122551908 14:102555047-102555069 CTTGCCATGGACTGGCTCCTGGG + Intergenic
1122888424 14:104721875-104721897 CCTTGCATGGCGAGGCTCCGTGG + Intronic
1124998385 15:34746148-34746170 CCATCCATGGAGAGGCGCCTGGG + Intergenic
1127688140 15:61368562-61368584 TCTTCCATAGACAGGATTCATGG + Intergenic
1127837339 15:62800461-62800483 CCTTCCATGTACCAGCTCAAGGG + Exonic
1129377912 15:75145636-75145658 GCTCCCAGGGACAGGCTCCAGGG + Intergenic
1131078390 15:89513649-89513671 CCTTCAATGGAGAGGCCACATGG - Intergenic
1131640112 15:94283367-94283389 GCTTTCATGGCCATGCTCCATGG + Intronic
1135113663 16:19708992-19709014 CCTTCCAGGGACAGCCCCCCGGG + Intronic
1135597729 16:23756237-23756259 CACACCAGGGACAGGCTCCAGGG + Intronic
1135785688 16:25347102-25347124 CATTCCTTGCACAGACTCCATGG + Intergenic
1138528112 16:57620453-57620475 CCGTCCATGCTCAGGCTCCGCGG - Intronic
1138558367 16:57785970-57785992 CTCTCCATGGCCAGGCTGCAAGG + Intronic
1139711989 16:68782822-68782844 CCGTCCCTGGACCAGCTCCATGG + Intronic
1140816445 16:78625313-78625335 CCTTGGATGGGGAGGCTCCAGGG - Intronic
1141144064 16:81516486-81516508 CCTTCCCTGGACACTCTCCCTGG + Intronic
1141897478 16:86967810-86967832 CCTTCCGTGGACAGCCTGCTTGG - Intergenic
1142280618 16:89145815-89145837 CTGTCCAAGGACGGGCTCCAGGG + Intronic
1142412024 16:89921747-89921769 CCTTCCTGGGACAGGCTCAATGG + Intronic
1143301021 17:5910760-5910782 CATTCCCTGAAAAGGCTCCACGG + Intronic
1146977857 17:37131125-37131147 CCTTCCCTTCCCAGGCTCCAGGG + Intronic
1148090772 17:45021393-45021415 CCTTCCATGATGAGCCTCCATGG - Intergenic
1148622436 17:49044502-49044524 CCTTCCCTGGCCAAGGTCCAGGG + Intronic
1148857437 17:50586440-50586462 CCCTCCATGGACATCCTCCCAGG + Intronic
1149979982 17:61303021-61303043 CCTTCCATGGCCAGTCTGAAAGG - Intronic
1150125086 17:62630017-62630039 CCTTCCAGTGACAGTCTCCGCGG - Intronic
1150227808 17:63533334-63533356 CCTCCCATGGAAAGAGTCCATGG - Intronic
1150634806 17:66905439-66905461 TTAGCCATGGACAGGCTCCAGGG - Intergenic
1150986524 17:70204071-70204093 TTTTCCATTTACAGGCTCCATGG - Intergenic
1151654958 17:75491513-75491535 CCCTCCCTGGCCAGGCTCCAAGG - Intronic
1151761191 17:76104075-76104097 CATTCTATGGGCAGGCACCAAGG + Intronic
1151896631 17:76985166-76985188 CCTTCCTTGGCCAGGCTCAGTGG - Intergenic
1151953655 17:77369795-77369817 CCCTCCAGGCACAGCCTCCATGG - Intronic
1152843286 17:82584077-82584099 CCTTCCCTCGACAGGCTCTCAGG - Exonic
1153759396 18:8316162-8316184 CCTTCCCTTGAGAGGCTCCAGGG + Intronic
1156615041 18:38772862-38772884 GCTTTCATGAACTGGCTCCAGGG - Intergenic
1156750723 18:40451312-40451334 CCTTCCTTTGACAGTCTCAATGG + Intergenic
1157299534 18:46469524-46469546 TCTGCCATGGGCAGGCTGCAAGG + Intergenic
1159772847 18:72568190-72568212 TCATCCATGCACTGGCTCCAGGG + Intronic
1160137035 18:76281273-76281295 ATTTCAATGGACAGGCTCAAGGG - Intergenic
1160343127 18:78107056-78107078 TCTTCCAGAGACAGGCTCCGCGG + Intergenic
1161358146 19:3831268-3831290 CCTGCCATGGGCAGGCCCCAGGG - Intronic
1161941042 19:7404271-7404293 CCTTCCCTGTCCTGGCTCCAGGG + Intronic
1163520314 19:17788033-17788055 CCTTCCAAGGACGTCCTCCAAGG - Intronic
1164717879 19:30406708-30406730 CATTCCACAGACAGTCTCCAGGG - Intronic
1166380067 19:42351109-42351131 CCTTACAGGGACAGTCTGCAGGG + Intronic
925227742 2:2200354-2200376 CCTTCCTTGTGGAGGCTCCAAGG + Intronic
925445333 2:3922525-3922547 ACTTCCATGGACTGGGTCCCTGG + Intergenic
925445587 2:3924078-3924100 ACTTCCATGGACTGGCTCCCTGG - Intergenic
927133410 2:20079811-20079833 CCTGCCCTGGCCTGGCTCCATGG + Intergenic
928466964 2:31531314-31531336 CATCCCTGGGACAGGCTCCAGGG + Intronic
932749675 2:74363402-74363424 CCATCCCTGGGCAGGCTCCAGGG - Exonic
935731849 2:106070793-106070815 CCTTCCATGGACAGGCTCCAGGG - Intronic
937928686 2:127188092-127188114 CTGTCCACGGACAGGCTCCTGGG + Intronic
938367242 2:130744612-130744634 CCCTCCCTTGACTGGCTCCAGGG + Intergenic
938789077 2:134660678-134660700 TCTGCCATGGACTGACTCCATGG - Intronic
946599211 2:221340892-221340914 CTATGCATGGACAGCCTCCAAGG - Intergenic
1170159548 20:13297624-13297646 CCCTCCATGGACAGGGCCGAAGG - Intronic
1170536034 20:17341863-17341885 TGTTCCATGAACATGCTCCAGGG + Intronic
1172198903 20:33111631-33111653 CCTTCCATGGTCAGCCTGCCAGG + Exonic
1173437269 20:43044347-43044369 CCTTCCCTGGCCAGTCTCCCTGG - Intronic
1175220925 20:57416061-57416083 ACTTCCTTGCACAGCCTCCACGG + Intergenic
1175228143 20:57457008-57457030 TGTTCCATGCAGAGGCTCCATGG + Intergenic
1175261041 20:57674271-57674293 CCTTCCATGTGCTGGCACCAAGG + Intronic
1175611752 20:60357582-60357604 CCTTCCAAGGAGAGGCTACTTGG + Intergenic
1175860313 20:62147031-62147053 CCTCCCATGCGCAGGCACCAGGG + Intronic
1176108162 20:63399188-63399210 CCCTCCAGGGACAGACCCCACGG - Intergenic
1176231671 20:64036190-64036212 GCTTCCCTGGACAGGCTGCCTGG - Intronic
1176268876 20:64225115-64225137 CCTCCCATGGAAAGGCCCCTGGG - Intronic
1177631775 21:23738156-23738178 CCTTCCATCAATAGACTCCATGG - Intergenic
1180202016 21:46229631-46229653 CCTTCCCTGGCGGGGCTCCAGGG - Intergenic
1180617523 22:17138153-17138175 TCCTCCAAGGACAGGCTCCGTGG + Exonic
1180694161 22:17741306-17741328 TGTTCCATGGACAGACTCCAGGG - Intronic
1182239910 22:28907537-28907559 CCTTTCATGGTCTGGTTCCATGG + Intronic
1183080042 22:35450441-35450463 CCCTCCTGGGACAGACTCCAGGG + Intergenic
1183483035 22:38075288-38075310 CCTGCCCAGGACAGGCACCAGGG + Exonic
1183672397 22:39280555-39280577 ACTCCCAGGCACAGGCTCCATGG - Intergenic
1183881011 22:40829727-40829749 TCTTGCATGGACAGGTTGCATGG - Intronic
1184442513 22:44526472-44526494 CCATGGATGGACAGGCCCCAGGG + Intergenic
1184651080 22:45919751-45919773 CCTGCCATGGCCAGGCTCTGGGG + Intergenic
1185073805 22:48671765-48671787 CTCTCCAGGGACAGGCACCAGGG - Intronic
1185103547 22:48854532-48854554 CCTAACATGCACAGGCTCAAAGG - Intergenic
949200888 3:1378118-1378140 TCATCCATGGACAGCCTTCAAGG - Intronic
950938362 3:16866634-16866656 TCTTCCAGGGAAAGCCTCCAGGG + Intronic
951642188 3:24848346-24848368 CCTTACAGGGCCAGGCGCCATGG - Intergenic
954985416 3:54786451-54786473 CCCTCCCTGCACTGGCTCCATGG + Intronic
955870714 3:63435619-63435641 AATTCCATGGAGATGCTCCAGGG - Intronic
956488913 3:69750966-69750988 CCTTCCATGGATAGGATTCTTGG + Intronic
960085483 3:113586060-113586082 CCATCCATGGAAAGACTTCATGG + Intronic
960954833 3:123024967-123024989 CCTGACATGGACAATCTCCAGGG + Intronic
961649516 3:128410436-128410458 GCTCCCATGGACAGCTTCCATGG - Intergenic
962264540 3:133935618-133935640 CCTGCCATGGACAGGGAGCAGGG - Intronic
964205693 3:154172405-154172427 CCTGCCATGGCCAGGCACCATGG + Intronic
967712792 3:192728126-192728148 TGTTCCATGAGCAGGCTCCAAGG + Intronic
968263260 3:197342011-197342033 CATTTCATGGTCAGCCTCCAGGG - Intergenic
968299340 3:197601243-197601265 CCTCTCACGGACAGGCGCCATGG + Intergenic
972495986 4:39635250-39635272 ACTCACATGGCCAGGCTCCAGGG + Intronic
977867504 4:102047140-102047162 CCTTCAATGGACCTGCTCCTAGG + Intronic
979107437 4:116705674-116705696 CCTTCCTTGCAGAGGCTGCAGGG - Intergenic
980395639 4:132211220-132211242 CCTTCAGAGGACAGGTTCCAAGG + Intergenic
980905441 4:138944144-138944166 CCTTCCATGCTCTGGCTACACGG - Intergenic
983902617 4:173152255-173152277 ACAGCCAGGGACAGGCTCCATGG - Intergenic
987227664 5:15860573-15860595 CTTTTCAAGGACTGGCTCCAAGG - Intronic
987650185 5:20731035-20731057 CCTTGAAAGCACAGGCTCCAGGG + Intergenic
988745374 5:34130432-34130454 CCTTGAAAGCACAGGCTCCAGGG - Intergenic
989486190 5:41994932-41994954 TCTTCCATGGCCAGGATTCATGG - Intergenic
992990459 5:82278208-82278230 GATGCCATGGAGAGGCTCCATGG - Intronic
995239119 5:109865808-109865830 CCTTTCAAGGACAGGCTTGATGG - Intronic
997258814 5:132449737-132449759 TCTTCCTTGGACAGTTTCCAAGG - Intronic
997368386 5:133340227-133340249 CCTTGCCTGGCCTGGCTCCAGGG + Intronic
997714886 5:136035120-136035142 CCTGCCCTGGACAGGCTCCCAGG - Intronic
998040225 5:138946859-138946881 GCATCCAGGAACAGGCTCCAGGG - Exonic
998444220 5:142186234-142186256 CTTTCCAGGGAGAGGGTCCATGG + Intergenic
1000338697 5:160260719-160260741 ACTGCCAAGGACAGGGTCCACGG - Intronic
1000897673 5:166875300-166875322 TCTTCCATATACAGGCTTCAAGG + Intergenic
1002764384 6:226713-226735 CCTTCCATGAAAAGTCTGCATGG - Intergenic
1005543490 6:26838184-26838206 CCTTGAAAGCACAGGCTCCAGGG - Intergenic
1006117950 6:31785234-31785256 CCTCCCACGCACAGGGTCCATGG + Exonic
1006620043 6:35357473-35357495 CCTTTCAAGGACATCCTCCAAGG + Intronic
1007841138 6:44716697-44716719 TCTTCCATGGAAGTGCTCCAGGG - Intergenic
1009014320 6:57880353-57880375 CCTTGAAAGCACAGGCTCCAGGG - Intergenic
1009375368 6:62961631-62961653 TCCTCCATGGGCAGGCACCAAGG + Intergenic
1012516954 6:100072866-100072888 CCCTCCCTGGACAGGGTCTAGGG + Intergenic
1012753038 6:103187024-103187046 CCTACCATGGAGAGACGCCAGGG - Intergenic
1017009185 6:150051543-150051565 CCATCCATGGTGAGGTTCCATGG - Intergenic
1018512434 6:164539991-164540013 CCTTGCATGGGCAGCCACCAAGG + Intergenic
1019156852 6:170044990-170045012 CCTCCCATGTGCAGGCTCCCTGG - Intergenic
1019540950 7:1550724-1550746 TCTTCCATGGCCAGTCCCCAGGG - Intronic
1021429588 7:20545282-20545304 GCTTCTATGGGCAGTCTCCATGG + Intergenic
1021962989 7:25891219-25891241 CCTTCCATGCACATGAACCATGG + Intergenic
1022475236 7:30705736-30705758 CCTTCCAGGAGCAGGCGCCATGG + Intronic
1023593173 7:41800191-41800213 CATTACATGGACAGGCACAAGGG + Intergenic
1023823150 7:43991217-43991239 CCTCCCAGGGCCAGGCTACAGGG - Intergenic
1023848928 7:44139846-44139868 CCTTCCAGGGACAGACCCCGAGG - Exonic
1023925130 7:44663199-44663221 CATTCAATGGATAGGCTCAATGG - Intronic
1025120586 7:56298264-56298286 CCTTCCAAGGCCAGGCGCCATGG - Intergenic
1025198510 7:56948886-56948908 CCCTCCATGGCCAGGGCCCAGGG + Intergenic
1025606660 7:63044490-63044512 CCTTCCCTGACCAGCCTCCATGG + Intergenic
1025673441 7:63628047-63628069 CCCTCCATGGCCAGGGCCCAGGG - Intergenic
1025795290 7:64733927-64733949 TCTGCCATGGAGAGGATCCATGG - Intergenic
1026433274 7:70369482-70369504 CCTTCCTTTGACACCCTCCAAGG - Intronic
1027672625 7:81120166-81120188 CCCTCCCTGCCCAGGCTCCAGGG - Intergenic
1028591429 7:92500161-92500183 CCTTTCATGGATATGCTTCATGG + Intronic
1029222121 7:98998891-98998913 CCTTACATGGAGAGGCCCCATGG + Intronic
1029751414 7:102544655-102544677 CCTCCCAGGGCCAGGCTACAGGG - Intronic
1029769366 7:102643748-102643770 CCTCCCAGGGCCAGGCTACAGGG - Intronic
1031105095 7:117531120-117531142 ACTTCCTTGCACAGGCCCCATGG + Intronic
1032777555 7:135129299-135129321 CCTTACATGGAGAGACCCCATGG - Intronic
1034415810 7:150963726-150963748 CCATCCCTGCACAGGCTCCATGG + Intronic
1035049307 7:155989517-155989539 CCTTCCCTGGGAAGGCTGCAGGG + Intergenic
1035363514 7:158329472-158329494 CCTTCCTTACACAGGCCCCAAGG + Intronic
1037752342 8:21690998-21691020 CCTTCCATGCAGAGGCTGGAAGG + Exonic
1037947054 8:22996193-22996215 CCTTCTGGGGACAGGTTCCAGGG + Intronic
1038346359 8:26735829-26735851 CCTTCAGTGCACAGGCTACAGGG + Intergenic
1039948107 8:42147261-42147283 CCTTTCATGGCCAGGCTTAAAGG + Intergenic
1039970851 8:42320608-42320630 CCCTCAATGGACTGGCTCAAAGG - Intronic
1042571074 8:70165744-70165766 GCATCCATGGATAGGCTACATGG + Intronic
1044150984 8:88774497-88774519 ACTTCCATAGACAGGATTCATGG + Intergenic
1048553704 8:135456492-135456514 CCTTCCCTGGACAGCCTCTCAGG - Intergenic
1049264011 8:141656778-141656800 CATTCCATGGATGGGCTCAACGG - Intergenic
1049439185 8:142601441-142601463 CCTACCATGGACAGGGCCCCAGG + Intergenic
1049706176 8:144043831-144043853 ACTGCCACGGACGGGCTCCACGG - Intronic
1053396562 9:37779765-37779787 CTTTCTATGGATAGGCTTCAGGG + Exonic
1061758779 9:132835239-132835261 TCTTCCATGGAGTGGCTTCAGGG - Intronic
1062343554 9:136104349-136104371 GCTTGCATGGGCAGGCTGCAGGG - Intergenic
1062375937 9:136261953-136261975 CCTCCCATGGCCAGGCTCTCGGG + Intergenic
1186103661 X:6182789-6182811 CCTTCCTTCGGAAGGCTCCAAGG - Intronic
1187272685 X:17793017-17793039 CCTTCCCTGGACAGCCTGGAGGG + Intergenic
1188358988 X:29229034-29229056 CCATCCAAGGACAAGTTCCAGGG + Intronic
1189303890 X:39972476-39972498 CCCTCCATGGTCATGCTGCATGG + Intergenic
1191631458 X:63326286-63326308 CCTCCCATGGCCAGGATTCATGG + Intergenic
1197963198 X:132028213-132028235 CCTTCCATGGACAGGTTCCATGG + Intergenic
1198503237 X:137274685-137274707 CCGTCCATGCACATGCTCAATGG + Intergenic
1199594784 X:149497994-149498016 CCTGCCATCGCCAGGCACCATGG - Intronic
1200142627 X:153909570-153909592 CCTTCCCTGCACGGGGTCCAGGG + Intronic