ID: 935733982

View in Genome Browser
Species Human (GRCh38)
Location 2:106091514-106091536
Sequence CAGTATCTAAGAGGGTGTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 100}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935733979_935733982 -8 Left 935733979 2:106091499-106091521 CCAGTGGGCTGCGCTCAGTATCT 0: 1
1: 0
2: 0
3: 1
4: 124
Right 935733982 2:106091514-106091536 CAGTATCTAAGAGGGTGTAGTGG 0: 1
1: 0
2: 0
3: 8
4: 100
935733977_935733982 1 Left 935733977 2:106091490-106091512 CCACCTGGGCCAGTGGGCTGCGC 0: 1
1: 0
2: 2
3: 19
4: 213
Right 935733982 2:106091514-106091536 CAGTATCTAAGAGGGTGTAGTGG 0: 1
1: 0
2: 0
3: 8
4: 100
935733972_935733982 20 Left 935733972 2:106091471-106091493 CCACAAGAGTCACAAGAGTCCAC 0: 1
1: 0
2: 1
3: 14
4: 156
Right 935733982 2:106091514-106091536 CAGTATCTAAGAGGGTGTAGTGG 0: 1
1: 0
2: 0
3: 8
4: 100
935733978_935733982 -2 Left 935733978 2:106091493-106091515 CCTGGGCCAGTGGGCTGCGCTCA 0: 1
1: 0
2: 3
3: 18
4: 203
Right 935733982 2:106091514-106091536 CAGTATCTAAGAGGGTGTAGTGG 0: 1
1: 0
2: 0
3: 8
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935733982 Original CRISPR CAGTATCTAAGAGGGTGTAG TGG Intergenic
901164900 1:7212765-7212787 AAGAGTCAAAGAGGGTGTAGGGG - Intronic
904042141 1:27591209-27591231 CAGCTTCTAGGAGGGTGCAGGGG - Intronic
904487328 1:30835444-30835466 CAGTATTTAACAGGGTGCCGTGG - Intergenic
904967936 1:34393881-34393903 AAGTAACTAAGAGGCTGAAGTGG - Intergenic
908371508 1:63484246-63484268 AAGTATATAGGAGGGTGTATTGG + Intronic
1062971922 10:1654692-1654714 CAGTCCCTCAGAGGGTGGAGTGG + Intronic
1063436624 10:6037162-6037184 CAGCGTCTAACAGGGTGCAGTGG + Intronic
1064488504 10:15823288-15823310 TAGTCTCTAAGAGGGTCTTGTGG - Intronic
1065814008 10:29468772-29468794 CAGTCTCTAAGTGTGTGTGGTGG + Intronic
1066203282 10:33162158-33162180 CAGTAGCTAACTGGGTGCAGTGG - Intergenic
1071896973 10:90078201-90078223 CAGTTTCTGTGAGAGTGTAGGGG - Intergenic
1074583114 10:114740101-114740123 AAGTATCTAAGAGTGTGTCTAGG + Intergenic
1076347181 10:129787270-129787292 CAGTATCTAACAGGATGTTGTGG - Intergenic
1078079035 11:8190830-8190852 CAGTATCTAAGATAGTCTATAGG - Intergenic
1084883125 11:72186259-72186281 CAGTAAGGAAGAGGGTGTACTGG - Intergenic
1086934502 11:92729920-92729942 CAGAATCTATGAGAGTCTAGTGG + Intronic
1087764854 11:102139634-102139656 AAGTAACTAAAAGGGAGTAGGGG - Intronic
1096936541 12:55286247-55286269 CAGTGTCTCAGAGGCTGGAGTGG + Intergenic
1100133470 12:91524511-91524533 CAGTGTGTAAGTGGGTATAGTGG + Intergenic
1106411826 13:29515974-29515996 AAGTATCTAACAGGGAGGAGAGG + Intronic
1106925313 13:34607273-34607295 CAGAATCCAATAGGTTGTAGAGG - Intergenic
1115439487 14:33415807-33415829 CAGTATCTAATAGGATGTAAAGG - Intronic
1117108008 14:52418534-52418556 CAGAATCTTGGAGGGGGTAGCGG + Intergenic
1118447121 14:65862146-65862168 CACTATCTGTGAGGGAGTAGAGG - Intergenic
1118931410 14:70245087-70245109 CAAAATCTAAAAGGGGGTAGGGG - Intergenic
1121308519 14:92922692-92922714 CAATATCTAGGAGGCTCTAGAGG - Intergenic
1121620852 14:95347319-95347341 CAGTATCTAAGAGTGAGCATGGG + Intergenic
1124157634 15:27241031-27241053 AATTATCTAAGAGGTTGTTGAGG - Intronic
1124197758 15:27647711-27647733 CAGTATTGAAGAAGGTGTGGTGG - Intergenic
1130168088 15:81483742-81483764 GAGTATCTAAGAGGGTGAGTAGG - Intergenic
1131039044 15:89245087-89245109 CAGTATGTAAGAGAGTTTACTGG + Intronic
1133576137 16:7092471-7092493 CAGTATTAAAGAGGCTGTTGTGG - Intronic
1134657597 16:15958929-15958951 CAGCATCTACTAGGGGGTAGAGG - Intronic
1136098767 16:27977983-27978005 CAGTAACTCAGAGGGGCTAGCGG - Intronic
1141608261 16:85167860-85167882 CAGTGTCCCAGAGGGTGGAGGGG + Intergenic
1146138603 17:30345066-30345088 CAGCATCTAGGAGGAAGTAGTGG + Intergenic
1146917081 17:36684918-36684940 CAGGGTCTCAGAGGGAGTAGAGG - Intergenic
1148763356 17:50021054-50021076 CAGTATCTGAAAGGGTGTGAGGG - Intergenic
1148975032 17:51520087-51520109 GAGGTTCTAAGAGGGTGGAGAGG - Intergenic
1149903248 17:60501434-60501456 CAATACCCAAGAGTGTGTAGTGG + Intronic
1152533560 17:80937144-80937166 CAGGAGCTAAGCGGGTGGAGAGG + Intronic
1152854114 17:82654164-82654186 CAGCATCGAACAGGGTGCAGCGG + Intergenic
1155875227 18:31078120-31078142 CAGTATCCATGAGGGAGGAGAGG + Intronic
1156987307 18:43362921-43362943 AAATATCAAAGAGGGTATAGAGG + Intergenic
1157151349 18:45221777-45221799 CAATGTCTTAGAGTGTGTAGAGG + Intronic
1159557088 18:69956848-69956870 CAGTGACCAAGAGGGTGTTGAGG - Exonic
1159716042 18:71824413-71824435 CTGAATCTCAGAGGGTGCAGCGG + Intergenic
1167860111 19:52276244-52276266 CAGTATATGGGAGGGTGCAGAGG - Intronic
926424532 2:12728913-12728935 CAGTATCTAACAGAGTACAGAGG + Intronic
927320410 2:21737691-21737713 CAGTGTTGATGAGGGTGTAGGGG + Intergenic
927999499 2:27510600-27510622 CAGTATGTATAAGGGTGTAAGGG - Intronic
928770773 2:34700303-34700325 CAGCATCCAAGATGGTTTAGGGG + Intergenic
930609147 2:53522076-53522098 CAGTATCTCAGAAGGTGTATTGG - Intergenic
934591745 2:95558632-95558654 CTGTATCTCAGTGGGTTTAGTGG - Intergenic
935733982 2:106091514-106091536 CAGTATCTAAGAGGGTGTAGTGG + Intergenic
936986774 2:118318952-118318974 CTTTATCTAAGAGGGTGGGGAGG + Intergenic
938092053 2:128440661-128440683 CAGATTCTGAGAGGGTGTACTGG + Intergenic
940954031 2:159708860-159708882 CAGTATTTAAAAGGATATAGAGG - Intergenic
942028415 2:171934446-171934468 CAGTAAGTTAGAAGGTGTAGAGG + Intronic
947598094 2:231426622-231426644 CATTTTCTGGGAGGGTGTAGTGG + Intergenic
1177390117 21:20458151-20458173 GAGTATCTAAGAAGGTCTTGAGG + Intergenic
1185221199 22:49630026-49630048 CAGAATCTAAGGGGTTGGAGAGG - Intronic
956321080 3:67996959-67996981 CAGAATCTATGGGAGTGTAGAGG + Intergenic
959466929 3:106699883-106699905 CAGTAAGTAAGAGGTTCTAGAGG - Intergenic
960168347 3:114429541-114429563 CAGTCTCTGAGAGGGTATTGAGG + Intronic
960702772 3:120452947-120452969 CAGATTCTGAGAGGGTGCAGTGG - Intergenic
962823836 3:139080840-139080862 CAGTATCATAGATGGTGCAGAGG + Intronic
964213170 3:154250373-154250395 CAGCATCTAAGAGGGGGGGGTGG + Intronic
964689235 3:159431321-159431343 AAGTAGCTATGAGGGAGTAGAGG + Intronic
964823904 3:160804824-160804846 CAGTTTCTTAGAGTGTGTGGAGG + Intronic
967889125 3:194352460-194352482 GGGTATGTAAGTGGGTGTAGGGG + Intergenic
980566698 4:134551681-134551703 CAGTATCTATGAAACTGTAGTGG - Intergenic
986439876 5:7771199-7771221 CAGTATCTCAGAGGGAGGAGGGG - Intronic
990227337 5:53669388-53669410 CAGTATTAACGAGGTTGTAGAGG - Intronic
991615283 5:68490843-68490865 CAGTATTTAAGAAGGTCAAGGGG - Intergenic
993696057 5:91063069-91063091 CAGTTTCTCGGAGGGTGAAGTGG - Intronic
994513181 5:100734536-100734558 GAGTATATAAGATGGTGCAGTGG + Intergenic
995593232 5:113721553-113721575 CAATATCAAAGAGGGTGTTTTGG - Intergenic
995700643 5:114931063-114931085 CAGTACCTAGAAGGGAGTAGAGG - Intergenic
998116718 5:139543441-139543463 CAGGATCTACGTGGGTATAGAGG - Intronic
999477358 5:151912762-151912784 CATTATCTATGAGGGGGTAGTGG + Intronic
1001489749 5:172146996-172147018 CAGTATCTCAGAAGGTCCAGAGG - Intronic
1003891998 6:10571899-10571921 CATTATCTCAGGGGGTGTGGAGG - Intronic
1003915715 6:10784729-10784751 CAATATCTACGCGGGTGGAGGGG - Intronic
1004233031 6:13850052-13850074 CAGTCTCTCAGACGGTGGAGAGG + Intergenic
1004962364 6:20804671-20804693 CAGTATCTATGATGTTGTACAGG + Intronic
1006425605 6:33961022-33961044 CAGTGACTAAGAGGCTGGAGTGG + Intergenic
1012900212 6:104996608-104996630 CAGTAATTAAGGAGGTGTAGAGG + Intronic
1013296347 6:108761398-108761420 CAGCATCTAAGTGGGTACAGAGG - Intergenic
1014759128 6:125335967-125335989 CAGTATCTAGGGGTTTGTAGGGG + Intergenic
1016899216 6:149084336-149084358 CAGGATCTAAGAGTGTTTGGGGG - Intergenic
1030127479 7:106168313-106168335 CTGTGTGGAAGAGGGTGTAGGGG + Intergenic
1032689180 7:134265697-134265719 CAGTATCAGAGAAGGTGTTGTGG + Intergenic
1033624559 7:143096114-143096136 CAGTATTTAAGAGGTTGAAATGG + Intergenic
1034144906 7:148861012-148861034 CAGTATCCATGGGGGTCTAGGGG + Intronic
1039683840 8:39774692-39774714 CATTATCCAAGAGGATGTGGAGG + Intronic
1041712828 8:60909528-60909550 CAGTAGCTAAGAGGGTGGAACGG + Intergenic
1047757508 8:127930035-127930057 CAGCATGTGAGAGGGAGTAGTGG - Intergenic
1049080562 8:140440218-140440240 CAGCATCTAGCAGGGTGCAGTGG + Intronic
1050119487 9:2293766-2293788 CAGACTCTAAGAGGTTGGAGTGG - Intergenic
1052443945 9:28534649-28534671 CAGTATCTAAGAGTTTTTAAGGG - Intronic
1053446741 9:38158764-38158786 AAGTTCCTAAGAGGGTGGAGGGG + Intergenic
1058102057 9:100927180-100927202 CAGACTCTAAGAGGATGTAGAGG + Intergenic
1058654119 9:107204125-107204147 AAATTTCTAAGAGGGGGTAGGGG - Intergenic
1060958794 9:127664375-127664397 CAGAATCTGAGAGCGTGCAGAGG + Intronic
1186436053 X:9544013-9544035 CAGGATCTAAGTGGGGGCAGGGG - Intronic
1187354756 X:18557459-18557481 CAGTATCTACGAGGATATAGAGG - Intronic
1188174423 X:26971495-26971517 CAGTTTCTAAGAGGAGGAAGTGG + Intergenic
1199803503 X:151274318-151274340 AAGTATTTAAGAGGCTGAAGTGG + Intergenic