ID: 935735294

View in Genome Browser
Species Human (GRCh38)
Location 2:106101956-106101978
Sequence ATGGAGGAGGAGAAGGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4918
Summary {0: 1, 1: 10, 2: 128, 3: 790, 4: 3989}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935735294_935735301 -3 Left 935735294 2:106101956-106101978 CCCTTCTCCTTCTCCTCCTCCAT 0: 1
1: 10
2: 128
3: 790
4: 3989
Right 935735301 2:106101976-106101998 CATCGTTACCAGTGAGGAGCAGG 0: 1
1: 0
2: 1
3: 6
4: 77
935735294_935735298 -9 Left 935735294 2:106101956-106101978 CCCTTCTCCTTCTCCTCCTCCAT 0: 1
1: 10
2: 128
3: 790
4: 3989
Right 935735298 2:106101970-106101992 CTCCTCCATCGTTACCAGTGAGG 0: 1
1: 0
2: 1
3: 5
4: 103
935735294_935735303 6 Left 935735294 2:106101956-106101978 CCCTTCTCCTTCTCCTCCTCCAT 0: 1
1: 10
2: 128
3: 790
4: 3989
Right 935735303 2:106101985-106102007 CAGTGAGGAGCAGGTCACTCTGG 0: 1
1: 0
2: 1
3: 22
4: 244
935735294_935735304 7 Left 935735294 2:106101956-106101978 CCCTTCTCCTTCTCCTCCTCCAT 0: 1
1: 10
2: 128
3: 790
4: 3989
Right 935735304 2:106101986-106102008 AGTGAGGAGCAGGTCACTCTGGG 0: 1
1: 0
2: 1
3: 20
4: 221
935735294_935735305 12 Left 935735294 2:106101956-106101978 CCCTTCTCCTTCTCCTCCTCCAT 0: 1
1: 10
2: 128
3: 790
4: 3989
Right 935735305 2:106101991-106102013 GGAGCAGGTCACTCTGGGTCAGG 0: 1
1: 0
2: 2
3: 10
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935735294 Original CRISPR ATGGAGGAGGAGAAGGAGAA GGG (reversed) Intronic
Too many off-targets to display for this crispr