ID: 935735298

View in Genome Browser
Species Human (GRCh38)
Location 2:106101970-106101992
Sequence CTCCTCCATCGTTACCAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 103}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935735293_935735298 30 Left 935735293 2:106101917-106101939 CCATGAGCTACAATTCTTAGAAG 0: 1
1: 0
2: 0
3: 9
4: 143
Right 935735298 2:106101970-106101992 CTCCTCCATCGTTACCAGTGAGG 0: 1
1: 0
2: 1
3: 5
4: 103
935735295_935735298 -10 Left 935735295 2:106101957-106101979 CCTTCTCCTTCTCCTCCTCCATC 0: 2
1: 50
2: 1080
3: 3327
4: 13841
Right 935735298 2:106101970-106101992 CTCCTCCATCGTTACCAGTGAGG 0: 1
1: 0
2: 1
3: 5
4: 103
935735294_935735298 -9 Left 935735294 2:106101956-106101978 CCCTTCTCCTTCTCCTCCTCCAT 0: 1
1: 10
2: 128
3: 790
4: 3989
Right 935735298 2:106101970-106101992 CTCCTCCATCGTTACCAGTGAGG 0: 1
1: 0
2: 1
3: 5
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935735298 Original CRISPR CTCCTCCATCGTTACCAGTG AGG Intronic
900121959 1:1052057-1052079 CTCCTCCATCCTTCCTGGTGGGG + Intronic
900306388 1:2010897-2010919 CTCACCCCTCGTTACCAGTCTGG - Intergenic
900732429 1:4271145-4271167 CTCCTCCATCGTCAGCAGAGGGG - Intergenic
912865180 1:113250208-113250230 GTCGTCCCTCGATACCAGTGGGG - Intergenic
915092663 1:153437435-153437457 CCCCTCACTCCTTACCAGTGTGG - Intronic
921069872 1:211649879-211649901 CTGCTCCCTCTTTACCAATGTGG + Intergenic
923167942 1:231385042-231385064 CACCTCCATTGCTACCACTGTGG - Intronic
923276536 1:232401604-232401626 CTCATACATAGTTACCAGAGTGG - Intronic
923976108 1:239265229-239265251 CTCCTTCATCTTTACCAATATGG + Intergenic
1064269043 10:13848815-13848837 CTCCTCCCTCCTTACCAAGGGGG + Intronic
1064535537 10:16353864-16353886 CACCTCCATTGTTACCATCGTGG - Intergenic
1067899334 10:50222216-50222238 TTTCTCCATAGTTACCATTGTGG - Intronic
1069434697 10:68370375-68370397 CTCTTCCATTGTTACCAGTGGGG - Intronic
1070636959 10:78136680-78136702 CTCCTCCATGGTTACACCTGGGG + Intergenic
1073171898 10:101517843-101517865 CACCTCCATAGCTACCACTGTGG + Intronic
1073703923 10:105960837-105960859 CTCCTCATTTGTTGCCAGTGAGG + Intergenic
1075400997 10:122161551-122161573 CTTCTCCCTCGTTAGCTGTGTGG - Intronic
1076084418 10:127612746-127612768 CACCTCCTTTGTTACCAGAGAGG - Intergenic
1076334018 10:129692896-129692918 CTCATCCGTCGTTCCCAGTGTGG + Intronic
1078628121 11:12976994-12977016 CTCCTCCATCTTTCCCACTGTGG + Intergenic
1080563544 11:33486831-33486853 CTGCTCCATCATCAGCAGTGGGG - Intergenic
1091835485 12:3582872-3582894 CTCCTCCATCCTTTCTAGGGTGG - Intronic
1094288556 12:28820104-28820126 TTCCTCCATCATTGTCAGTGAGG - Intergenic
1099443779 12:82728659-82728681 CTCCTCAAGCGTGACCAGAGTGG - Intronic
1101235312 12:102782839-102782861 CACCTCCACTGTTACCAATGTGG + Intergenic
1102776544 12:115524729-115524751 CTTCTCCACCCCTACCAGTGGGG + Intergenic
1103528134 12:121580771-121580793 CTCCCCCAACATTACCTGTGTGG + Exonic
1104939695 12:132389120-132389142 CTCCTGCACCCTTCCCAGTGGGG - Intergenic
1108802924 13:54121414-54121436 CTTCTCCATTCTGACCAGTGAGG + Intergenic
1108938371 13:55915631-55915653 CTGCTCCATCCTTCCCACTGGGG - Intergenic
1110322674 13:74177718-74177740 CTTCTCCATCGGCACCACTGTGG - Intergenic
1110554180 13:76840024-76840046 CTCCTCCATCAGTATCAGTTTGG - Intergenic
1119338021 14:73851310-73851332 TTCCTCCAAGATTACCAGTGTGG - Intergenic
1119940330 14:78633920-78633942 CTCCTCCTTTGTTAGCACTGTGG - Intronic
1120862315 14:89265949-89265971 CTCCTCCTTCACCACCAGTGAGG - Intronic
1121327104 14:93027511-93027533 CTCCTTCATCATTAGCTGTGTGG - Intronic
1121619450 14:95336232-95336254 CTCCTCGATCCTGACCAGAGAGG - Intergenic
1125729157 15:41883066-41883088 CTCCTCCCTGGGCACCAGTGTGG - Exonic
1127368001 15:58309492-58309514 CTCAGCCAGCGTGACCAGTGTGG + Intronic
1128765820 15:70250601-70250623 CTCCTCCATGGTACCCAGCGTGG + Intergenic
1132652531 16:1028072-1028094 ATCCTCCATCGTTTCCACCGTGG - Intergenic
1135927499 16:26708375-26708397 CTCCTCCATCCTCCCCAATGGGG - Intergenic
1136927798 16:34389785-34389807 CTCCTCCATCTTGAGGAGTGGGG + Intergenic
1136976776 16:35022021-35022043 CTCCTCCATCTTGAGGAGTGGGG - Exonic
1138089938 16:54165682-54165704 CTCAGCCATAGTTACCAGTTAGG - Intergenic
1138287747 16:55822888-55822910 CTCCTCCATCCATGCCAGTCAGG - Intronic
1144322027 17:14134882-14134904 GTTCTGCAACGTTACCAGTGTGG - Intronic
1145755435 17:27386610-27386632 CTCCTCCATCCTCACCAGGCTGG - Intergenic
1146974124 17:37096548-37096570 CTCCTCCATCCTTCCCAGAGAGG + Intronic
1148495388 17:48050620-48050642 CTCCTCCACACTTACCAGGGGGG - Exonic
1152595770 17:81236916-81236938 CTCCTCCATCCTCACCACCGTGG + Intronic
1156758999 18:40564085-40564107 CACCTCCAGCGTTCCCATTGTGG - Intergenic
1157790117 18:50524063-50524085 CTCCTTCAAGGATACCAGTGTGG + Intergenic
924990739 2:310731-310753 CTCCTCCATCTTTACCCGGCTGG - Intergenic
925416618 2:3674553-3674575 CTCCTCCGTCATACCCAGTGTGG + Intronic
925619832 2:5781533-5781555 CTCCTACATCTGTAGCAGTGAGG - Intergenic
935735298 2:106101970-106101992 CTCCTCCATCGTTACCAGTGAGG + Intronic
942665670 2:178314290-178314312 CACCTCCAGTGTTACCAGTAAGG + Intronic
943312399 2:186343278-186343300 GTCCTCCATCATTATCAGTATGG + Intergenic
1174108356 20:48179530-48179552 CTCCCCTATTGTTACCAATGAGG - Intergenic
1176050318 20:63115879-63115901 CTCTTCCATAGTTTCCAGTCTGG - Intergenic
1180999642 22:19982047-19982069 CTCCGGCATCGTGGCCAGTGAGG + Exonic
1182593208 22:31398175-31398197 CTCCTCCATTGCTAATAGTGTGG + Intergenic
1183257562 22:36772135-36772157 CTCCTTCATCTTTATCTGTGTGG + Intronic
1183523073 22:38307669-38307691 CTCCACCTTCGGTACCTGTGGGG - Intronic
1184392706 22:44214087-44214109 CTCCTCCATAGGTCCTAGTGAGG + Intronic
951044699 3:18024971-18024993 CTCCTGCAGCGTTACTAGCGGGG + Intronic
952764377 3:36942552-36942574 CTCCTGCATGGATCCCAGTGGGG - Intronic
953714531 3:45306556-45306578 CTCCTCAAGCGTGACCAGAGTGG - Intergenic
958673380 3:97233228-97233250 CTACTCCATCAATATCAGTGAGG + Intronic
960007183 3:112792230-112792252 CTGCTACATCTTTACCAGTCTGG - Intronic
961542903 3:127612125-127612147 CTCCGTCAGCGTTACCAGAGAGG - Intronic
962398299 3:135036376-135036398 CTCCTCCATCCTGACCGGTTTGG - Intronic
967533316 3:190573940-190573962 TTCTTCCATCGTTACAAGTGAGG + Intronic
971650235 4:29262346-29262368 CTTCTCCATTGTTACCATAGTGG - Intergenic
972666913 4:41173926-41173948 CTTCTCCATCTTTAACACTGGGG - Intronic
978566659 4:110089829-110089851 CACCTCCATCATCACCATTGTGG - Intronic
983273007 4:165585629-165585651 CTCCTCCATGGTAAGAAGTGTGG - Intergenic
989954919 5:50347346-50347368 CTTCTCCAACCTTCCCAGTGGGG - Intergenic
990665775 5:58069582-58069604 CTCCTCCAGCGTGGCCAGAGTGG + Intergenic
991360898 5:65818838-65818860 CTCCTCCATCCTTCCCAGCATGG - Intronic
998740196 5:145192094-145192116 CTCCTCCATCAGTTCCACTGTGG + Intergenic
999124951 5:149239881-149239903 CTCCCCCTTCCTTACCAGAGCGG - Exonic
1001301329 5:170535925-170535947 CTCCTCCAGCCCCACCAGTGTGG + Intronic
1002140419 5:177134126-177134148 CTCCTCCATCACTACCAGCCGGG + Intronic
1002416352 5:179122820-179122842 CTCCTCCAGCTCTGCCAGTGCGG - Intronic
1003134277 6:3421731-3421753 CCCCACCATCGCTACCACTGTGG - Intronic
1004851202 6:19701631-19701653 CTCCTTCAGAGTTCCCAGTGTGG - Intergenic
1006509995 6:34516465-34516487 CTCCTCCTTCCTGACCAGGGTGG + Intronic
1007071405 6:39040937-39040959 CTCCTCCTTCCTTACCTGGGGGG + Intergenic
1008690527 6:53973659-53973681 GTTCTCCATCATTACCATTGTGG + Intronic
1013284046 6:108664983-108665005 CTGCTCCATGGTTTTCAGTGTGG - Intronic
1023479067 7:40613438-40613460 CTCCTCCATCTATCCCAGTTGGG - Intronic
1024225038 7:47320202-47320224 CTCGTCCATCTATACCTGTGAGG + Intronic
1024881908 7:54096327-54096349 CTCCTGCATCCCTACCTGTGAGG - Intergenic
1033031782 7:137833796-137833818 CTCCACCATGGTAACCAATGAGG - Intronic
1040794108 8:51271112-51271134 CTCCTCAAGCGTGACCAGAGTGG - Intergenic
1046573700 8:115998731-115998753 CTCCTCCAAAGTTACCACAGAGG + Intergenic
1047894620 8:129352915-129352937 CTGCTCGATCTTTCCCAGTGTGG + Intergenic
1049553344 8:143270691-143270713 CTCCTGTCCCGTTACCAGTGGGG + Intronic
1049812014 8:144579875-144579897 CTCCTCCATCCTCTCCAGAGTGG + Intronic
1049827218 8:144676842-144676864 CTCCTCCAGCGTGGCCAGAGCGG + Intergenic
1057371896 9:94480673-94480695 CTCCTCCACCGCTGCCACTGAGG - Intergenic
1058487350 9:105455375-105455397 CCCCTCCATCGACTCCAGTGGGG - Intronic
1060899231 9:127242967-127242989 CTCCTCCTTGCTTACCAGCGGGG + Intronic
1061304897 9:129726555-129726577 CTCCTCCACCGTAAACACTGAGG - Intergenic
1061951219 9:133936916-133936938 ATCGTCCATGGTTTCCAGTGAGG - Intronic
1195418544 X:104647198-104647220 CTCCTCCAGCTGTCCCAGTGGGG - Intronic
1196987445 X:121290478-121290500 TTTCTCAATCTTTACCAGTGTGG - Intergenic
1197059430 X:122159888-122159910 CTCTTACATCATTACCAATGTGG + Intergenic