ID: 935735303

View in Genome Browser
Species Human (GRCh38)
Location 2:106101985-106102007
Sequence CAGTGAGGAGCAGGTCACTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 244}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935735296_935735303 -1 Left 935735296 2:106101963-106101985 CCTTCTCCTCCTCCATCGTTACC 0: 1
1: 0
2: 5
3: 56
4: 742
Right 935735303 2:106101985-106102007 CAGTGAGGAGCAGGTCACTCTGG 0: 1
1: 0
2: 1
3: 22
4: 244
935735295_935735303 5 Left 935735295 2:106101957-106101979 CCTTCTCCTTCTCCTCCTCCATC 0: 2
1: 50
2: 1080
3: 3327
4: 13841
Right 935735303 2:106101985-106102007 CAGTGAGGAGCAGGTCACTCTGG 0: 1
1: 0
2: 1
3: 22
4: 244
935735299_935735303 -10 Left 935735299 2:106101972-106101994 CCTCCATCGTTACCAGTGAGGAG 0: 1
1: 0
2: 0
3: 2
4: 78
Right 935735303 2:106101985-106102007 CAGTGAGGAGCAGGTCACTCTGG 0: 1
1: 0
2: 1
3: 22
4: 244
935735294_935735303 6 Left 935735294 2:106101956-106101978 CCCTTCTCCTTCTCCTCCTCCAT 0: 1
1: 10
2: 128
3: 790
4: 3989
Right 935735303 2:106101985-106102007 CAGTGAGGAGCAGGTCACTCTGG 0: 1
1: 0
2: 1
3: 22
4: 244
935735297_935735303 -7 Left 935735297 2:106101969-106101991 CCTCCTCCATCGTTACCAGTGAG 0: 1
1: 0
2: 0
3: 6
4: 83
Right 935735303 2:106101985-106102007 CAGTGAGGAGCAGGTCACTCTGG 0: 1
1: 0
2: 1
3: 22
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935735303 Original CRISPR CAGTGAGGAGCAGGTCACTC TGG Intronic
900556846 1:3284944-3284966 CAGAGGGGAGCAGGTCACTCAGG - Intronic
900584990 1:3428401-3428423 CTGTGAGAAGCAGGGCACTGTGG - Intronic
901107613 1:6769576-6769598 CACTGAGGAGCCAGTCACTTTGG - Intergenic
902755725 1:18548094-18548116 GAGAGAGGAGGAGGTCCCTCTGG - Intergenic
903560649 1:24224655-24224677 CAGTGATGAGCAGGGCCATCTGG + Intergenic
905229632 1:36507177-36507199 TGGTGAGGAGCAGGTGACTTAGG + Intergenic
905478398 1:38244908-38244930 CAGGGGGGAGCAGGGCGCTCAGG + Intergenic
906098260 1:43238800-43238822 CACGGAGGAGCAGGGCTCTCTGG + Intronic
918042540 1:180921982-180922004 CAGTGAGGAGCACAGCAATCAGG + Intronic
918934880 1:190909715-190909737 CAGTGAAGAGCACTTAACTCTGG + Intergenic
919580966 1:199372145-199372167 CAGTGAGCACCAGGTCAAACAGG + Intergenic
920030385 1:203034252-203034274 CAGTGAGGAGCTGGGCAAACAGG + Intronic
920346436 1:205308767-205308789 CAGTGGAGAGCAGTGCACTCTGG - Intronic
920382760 1:205545140-205545162 AAGTGAGGAGCACCTCTCTCTGG - Intergenic
1062798437 10:361623-361645 GAGAGAGGATCAGGTCACTTCGG + Intronic
1064070256 10:12222853-12222875 CAGTGATGAGCATGTCGGTCTGG - Intronic
1065774858 10:29110216-29110238 GTTTGAGCAGCAGGTCACTCTGG + Intergenic
1067457245 10:46427820-46427842 CATTCAGGAGCAGGGCACTCAGG - Intergenic
1067629957 10:47956818-47956840 CATTCAGGAGCAGGGCACTCAGG + Intergenic
1069681688 10:70290132-70290154 CAGTGAGGAGCGGGTCAGGTGGG - Intergenic
1070369937 10:75772816-75772838 CCCTGAGGGGCAGGGCACTCTGG - Intronic
1070487701 10:76946344-76946366 CAGTGAGTTGAAGGTAACTCAGG - Intronic
1073180101 10:101578341-101578363 CAGACAGGAGCAGGTCCCGCTGG - Intronic
1073382740 10:103092532-103092554 CAGTGTGGTGAAGGTGACTCCGG - Intronic
1074304016 10:112259812-112259834 CAGAGAGGAGCAAATCACTAGGG - Intergenic
1075213085 10:120508436-120508458 CAGAGAGGAGCTTGTCACTGGGG - Intronic
1075225849 10:120628354-120628376 CAGGGAGGGGCAGGAAACTCTGG + Intergenic
1076796328 10:132800070-132800092 CATTGAGGGGCAAGTGACTCGGG + Intergenic
1077102613 11:828857-828879 GCGTGAGGGGCAGGTCGCTCTGG - Exonic
1077269306 11:1667572-1667594 CAGTGTGGGTCAGGTCACTGTGG + Intergenic
1078616966 11:12875306-12875328 CACAGAGGAGCAGTTCACTCAGG + Intronic
1078729871 11:13964296-13964318 CAGGGATGAGCGGGTCACTGGGG + Intronic
1079405987 11:20146159-20146181 AAGAGAGGAGCAGATCACCCAGG + Intergenic
1082879546 11:58024662-58024684 CAGAGAGGAGAGGGTCACACGGG - Intronic
1082924325 11:58529980-58530002 CCGTGAGGAACAGTGCACTCCGG + Intronic
1085225938 11:74921260-74921282 CTGTGAGGAGCAGGACACGGAGG + Exonic
1088315231 11:108499471-108499493 GAGTGAGGAGCTGGGCACTGGGG + Intergenic
1096849726 12:54427889-54427911 CAGAGAGGAACGGGTCACTTTGG + Intergenic
1104831940 12:131758268-131758290 AAGTGTGGAGAAGGTCACGCTGG - Intronic
1104971703 12:132533769-132533791 TTGTGAGGAGCACGTCACACAGG + Intronic
1105973661 13:25454119-25454141 CACTGTGGAGCATGTCACTCAGG + Intronic
1106419927 13:29577660-29577682 CAGTGAGGAGCAGGACAACTTGG - Intronic
1107726575 13:43305539-43305561 CAATGGGCAGCAGGTGACTCAGG + Intronic
1111114150 13:83754373-83754395 CTGTGAGGAACAGTGCACTCCGG + Intergenic
1113412747 13:110104868-110104890 CCGTGAGGAGCAGTCCAATCCGG + Intergenic
1113616636 13:111685136-111685158 CAGTCAGGAGAAGGTCACAGAGG - Intergenic
1113622166 13:111770407-111770429 CAGTCAGGAGAAGGTCACAGAGG - Intergenic
1115206230 14:30908538-30908560 AAGTGACTAGCAGGTCACCCAGG - Intronic
1115940397 14:38602028-38602050 CTGTGAGGAACAGTGCACTCTGG - Intergenic
1116225081 14:42140178-42140200 CAGTGAGGGTCAGGTGAGTCAGG - Intergenic
1118565171 14:67131698-67131720 AATTGAGGAGCAGCTCTCTCAGG + Intronic
1118892531 14:69921963-69921985 CAGGCAGGAGCAGTTCACCCAGG - Intronic
1119762012 14:77158283-77158305 GAGTGAGGAGCAGGCCAAGCAGG + Intronic
1122263441 14:100535837-100535859 CAGTGGGGAGCACCTCACCCAGG - Intergenic
1123010870 14:105348949-105348971 GAGAGGGGAGCAGGGCACTCTGG + Intronic
1124605034 15:31163349-31163371 CAGGGAGGGGGAGGTCACCCAGG - Intergenic
1124725477 15:32152565-32152587 AAGGGAGGAGCAGGGCACGCAGG + Intronic
1126725085 15:51623137-51623159 GAGTGGGGTGCAGGTCGCTCGGG + Intergenic
1128237327 15:66077194-66077216 CAGTGCTGAGCAGGTCAGTGTGG - Intronic
1130650827 15:85761190-85761212 CACTGAGTGGCAGGTGACTCAGG + Intronic
1130978029 15:88792203-88792225 CAGGCAGGGCCAGGTCACTCAGG + Intergenic
1132038497 15:98505597-98505619 CAGAGAGGAGCAGCTCAGACAGG + Intronic
1137508510 16:49077726-49077748 CAGGGAGGGGCAGATCAGTCTGG + Intergenic
1137803538 16:51283196-51283218 GACTGAGGAGCAGTTCACTGAGG - Intergenic
1138633630 16:58319385-58319407 CAGTGAGGGGCAGGACCCACAGG - Intronic
1140820307 16:78657149-78657171 CAGTGATGAGCAGGACACATTGG - Intronic
1141134736 16:81457938-81457960 CAGCGAGGGGGAGGTCAGTCGGG - Intronic
1141516972 16:84551860-84551882 CAGTGAGGGGGAGGCCAGTCAGG - Intronic
1141790230 16:86229467-86229489 CAGTGTGAAGGAGGCCACTCAGG + Intergenic
1142158019 16:88541570-88541592 AATTGAGGAGCAGGTTACTTAGG + Intergenic
1142536464 17:620273-620295 CAGGGTGGAGCAGGTGAATCGGG - Intronic
1142714146 17:1738833-1738855 GAGTGAGGAGCAGGACAGTGAGG + Intergenic
1142714258 17:1739328-1739350 GAGTGAGGAGCAGGACAGTGAGG + Intergenic
1142714279 17:1739418-1739440 GAGTGAGGAGCAGGACAGTGAGG + Intergenic
1142714329 17:1739641-1739663 GAGTGAGGAGCAGGACAGTGAGG + Intergenic
1142714393 17:1739911-1739933 GAGTGAGGAGCAGGACAGTGAGG + Intergenic
1142714436 17:1740091-1740113 GAGTGAGGAGCAGGACAGTGAGG + Intergenic
1142714520 17:1740451-1740473 GAGTGAGGAGCAGGACAGTGAGG + Intergenic
1142714574 17:1740676-1740698 GAGTGAGGAGCAGGACAGTCAGG + Intergenic
1142714684 17:1741126-1741148 GAGTGAGGAGCCGGACACTGAGG + Intergenic
1142714789 17:1741576-1741598 GAGTGAGGAGCAGGACAGTGAGG + Intergenic
1142714809 17:1741666-1741688 GAGTGAGGAGCAGGACAGTGAGG + Intergenic
1142714832 17:1741756-1741778 GAGTGAGGAGCAGGACAGTGAGG + Intergenic
1142714885 17:1741979-1742001 GAGTGAGGAGCAGGACAGTGAGG + Intergenic
1142714897 17:1742024-1742046 GAGTGAGGAGCAGGACAGTGAGG + Intergenic
1143795758 17:9335054-9335076 CAGTTAGGAACAGGTGACTCAGG - Intronic
1144814086 17:18021167-18021189 CTGTCAGGCGCAGGTCAATCAGG + Exonic
1145097971 17:20048037-20048059 CAGTAAGGAGCAGGGCCCACAGG + Intronic
1146464481 17:33075408-33075430 CAGTGAGGAGAAGGACAAGCAGG - Intronic
1146973317 17:37090541-37090563 CAGAGAGGAGAGGGTCACTCAGG - Intronic
1147472689 17:40677802-40677824 TAGAGAGGAGTAGCTCACTCAGG + Intergenic
1148789272 17:50164304-50164326 CAGGGATGAGCGGGTCAGTCAGG + Intronic
1148978926 17:51554193-51554215 CAGTGTGCAGGATGTCACTCAGG + Intergenic
1149656274 17:58311019-58311041 CGGTGAGGGGCAGGAGACTCGGG + Exonic
1150676205 17:67246853-67246875 AGGTGAGAAGCAGGTGACTCAGG - Intergenic
1151670365 17:75568816-75568838 CTGTGAGCAGCAGGTCCCTCTGG - Exonic
1151671505 17:75573914-75573936 CAGTGAGGACCAGGGCCCCCGGG - Intronic
1152889128 17:82870178-82870200 CGGTGAGGAGCAGACCACACGGG - Intronic
1154055956 18:11014230-11014252 CAGTGGGGAACATGTCACCCTGG + Intronic
1154056007 18:11014447-11014469 CAGTGGGGAACATGTCACCCTGG + Intronic
1154056037 18:11014557-11014579 CAGTGGGGAACATGTCACCCTGG + Intronic
1154056053 18:11014611-11014633 CAGTGGGGAACACGTCACTCTGG + Intronic
1154056066 18:11014666-11014688 CAGTGGGGAACATGTCACCCTGG + Intronic
1154056100 18:11014777-11014799 CAGTGGGGAACATGTCACCCTGG + Intronic
1157041201 18:44041640-44041662 CAGGGAGAAGCAGGTCAATCTGG - Intergenic
1157574187 18:48732738-48732760 CATACAGGAGCAGGTCACACTGG - Intronic
1158010416 18:52721604-52721626 CAGTGAGGAGGACTTCACTAAGG + Intronic
1159030181 18:63222999-63223021 CAGTGAGGAGCAGGAAAGTTAGG + Intronic
1160149787 18:76390434-76390456 CGGGGTGGAGCAGGTCACCCAGG + Intronic
1160736560 19:665327-665349 CAGCGAGGGGCAGGTGACTCGGG - Intergenic
1160805406 19:990327-990349 CAGTGAGGAGGTGGCCACCCGGG - Exonic
1161496074 19:4586570-4586592 CAGTGAGGTGTAGGGAACTCAGG - Intergenic
1161765026 19:6202779-6202801 CAGTGAGGAGGAGGCCCCTGTGG + Intergenic
1161982039 19:7635008-7635030 CAGTGAGCATGAGGTCACACTGG - Intronic
1162588991 19:11578564-11578586 AGGTGAGGAGCAGGTCAGACCGG - Exonic
1163232735 19:16015390-16015412 CAGTGAGGATCAGATCAGTGCGG + Intergenic
1166799744 19:45449365-45449387 CAGTGAGGAGCTGGACGCTGTGG + Intronic
1168311856 19:55464620-55464642 CAGGGAGGGGCAGGGGACTCTGG + Intergenic
924967553 2:92247-92269 CCGTGAGGAACAGTGCACTCTGG + Intergenic
927111690 2:19868649-19868671 CAGTGAAGTGCAGCTCACCCGGG + Intergenic
927808843 2:26170984-26171006 CAGGGAGGAGCTGCTCACCCCGG - Intergenic
927970757 2:27305114-27305136 CAGAGAGGAGCAGTTCTCTTGGG - Intronic
928083898 2:28333725-28333747 CAGTGAGGAGCTTGACACTCAGG + Intronic
930307596 2:49694747-49694769 CAGTGGTGACCTGGTCACTCTGG - Intergenic
930373440 2:50533870-50533892 GAGTGGGTAGCAGGTCTCTCTGG - Intronic
935735303 2:106101985-106102007 CAGTGAGGAGCAGGTCACTCTGG + Intronic
936154618 2:110039993-110040015 CTGGGAGGAGCAGGAAACTCGGG - Intergenic
936190065 2:110331421-110331443 CTGGGAGGAGCAGGAAACTCGGG + Intergenic
937236751 2:120435881-120435903 CAGTGGACAGAAGGTCACTCTGG + Intergenic
937921488 2:127134826-127134848 GACTGAGGAGGAGGTCACTGTGG - Intergenic
937929375 2:127192646-127192668 CAGTTAGGAGCTGGCCTCTCAGG - Intronic
939953618 2:148505438-148505460 CAGTGAGGAGGAGGAGAATCAGG + Intronic
941992614 2:171571845-171571867 CAGAGAGGAGCTGGCCTCTCCGG - Intergenic
942010928 2:171761731-171761753 CTGTGAGGAACAGTGCACTCCGG - Intergenic
944225593 2:197346041-197346063 CAGTGAGGTGCGTGTGACTCAGG - Intergenic
946638470 2:221756730-221756752 CAGGGAGGAGCATGTGACTTAGG - Intergenic
947743015 2:232493507-232493529 CAGAGGGCAGCAGGGCACTCAGG + Intergenic
947808039 2:232982026-232982048 TGGTGAGGAGCAGGTCACAGGGG + Intronic
947855262 2:233319647-233319669 CAGAGAGGAGCAGGGCACCCAGG - Intronic
947960321 2:234230904-234230926 CATTGAGGAGAATGTAACTCTGG - Intergenic
948376760 2:237525844-237525866 CATGGGGGAGCAGGTCACTGAGG + Intronic
948674289 2:239587958-239587980 AAGTGAGGAGAAGGTGACTTCGG - Intergenic
948769318 2:240240326-240240348 CTGTAAGGATCAGGTCACTATGG - Intergenic
948836107 2:240626745-240626767 CAGTGAGGTGCAGATCCCTGTGG - Intronic
948862975 2:240761853-240761875 CAGTGGGGAGCAGGGCCCACAGG + Intronic
1170275235 20:14578850-14578872 CAGGGAGGAGCGTGTGACTCTGG + Intronic
1170889173 20:20364601-20364623 CAGGGAGGCGCTGGTCCCTCCGG + Intergenic
1171371972 20:24668298-24668320 TAGGGAGGTGCAGGTCGCTCCGG - Intergenic
1172176895 20:32977881-32977903 CAGTGCCCAGCAGGCCACTCAGG + Intergenic
1172507373 20:35473484-35473506 CACTGGGGAGCGGGACACTCTGG + Exonic
1173122647 20:40307836-40307858 CAGTGAGAAACAGGAGACTCTGG + Intergenic
1174569854 20:51493784-51493806 CAGTGGGGAGCAGCTCTCTGGGG - Intronic
1174592797 20:51659330-51659352 CAGTGATGAGTAACTCACTCAGG - Intronic
1174873371 20:54204092-54204114 CGGTGTGGAGCTGGTCACTGTGG - Intergenic
1175058664 20:56221353-56221375 CAGGATGGAGCAGGTGACTCAGG - Intergenic
1175215018 20:57387648-57387670 CAGAGAGGAGCAGGTGAGGCCGG - Intergenic
1175269312 20:57722668-57722690 CAGTGAGGAGCAGCAAATTCGGG + Intergenic
1175698990 20:61123762-61123784 CAGTGTGGAGAAGGGCACTCAGG + Intergenic
1176246493 20:64099682-64099704 CAGTGTGGGGCAGGTGTCTCAGG + Exonic
1178350045 21:31866331-31866353 CAGTGAGGCGGAGGGCACCCTGG - Intergenic
1178605937 21:34036616-34036638 CAGTGAGGAGATTGTTACTCAGG + Intergenic
1179730956 21:43367185-43367207 CAGTTAGGATGAGGTCACCCTGG + Intergenic
1181115744 22:20631777-20631799 CAGAGAGGAGCAGATCCCTTAGG + Intergenic
1181861977 22:25826172-25826194 GAGTGATGAGCAGATCACTCTGG + Intronic
1182019718 22:27071372-27071394 CAGTGGGGAACAGCTGACTCAGG - Intergenic
1182041446 22:27241785-27241807 CAGTGAGGAGATGGTCTCTGTGG + Intergenic
1183716001 22:39534107-39534129 CAGAGAGGCGAAGGTCACACGGG + Intergenic
1184599202 22:45532684-45532706 CAGTGAGGAGCAGGTACATGAGG + Intronic
950213959 3:11144656-11144678 CAGGGAGGAGCAGGTCTTCCTGG + Intronic
950562040 3:13736580-13736602 CCATGAGGAACAGGGCACTCTGG - Intergenic
950693599 3:14680830-14680852 CAGTCAGGATCAGATCCCTCTGG + Intronic
950958216 3:17077867-17077889 CAGAGAGGAGCAGCTACCTCGGG - Intronic
953315799 3:41925347-41925369 CCGTGAGGAACAGTGCACTCCGG + Intronic
954361594 3:50125358-50125380 CTGTGAGGGGCAGGGGACTCAGG + Intergenic
955065960 3:55533898-55533920 CAGCGAGGGGCAGGTCACCCAGG + Intronic
955208167 3:56916364-56916386 CAGTTAGGAGCCGGTGAGTCCGG - Intronic
955458904 3:59157850-59157872 CACTGAGGTGCTGGACACTCAGG + Intergenic
959249789 3:103927114-103927136 CAATGAGGATCAGGTCTGTCAGG + Intergenic
959424592 3:106170659-106170681 CAGAGAGGAGATGGTCAGTCTGG + Intergenic
960908822 3:122628304-122628326 AAGTGTGGAGCATGTGACTCTGG - Intronic
960948858 3:122985660-122985682 CAGTGAGCAGCTGGGCACTGGGG - Intronic
961841583 3:129718393-129718415 GAGAGAGGAACTGGTCACTCAGG - Intronic
963436242 3:145270665-145270687 CAGTGAGGAGAAGATCAAACTGG + Intergenic
966255699 3:177914447-177914469 AAGTGAGGAGCACCTCTCTCTGG - Intergenic
967562722 3:190935220-190935242 CAGTGAGGCACAGAACACTCTGG - Intergenic
968349661 3:198043358-198043380 CAGAGAGGAGCCTGTCTCTCAGG + Intronic
968441910 4:628588-628610 CAGGGAGGAGCGGGTTACCCGGG - Intronic
968447365 4:658474-658496 CTGTGTGGGGCAGGTCACCCAGG + Intronic
968630702 4:1649528-1649550 TGGTGAGGACCAGGTCACACAGG + Intronic
969909245 4:10428271-10428293 CTGTGAGGAACAGTGCACTCTGG - Intergenic
981077755 4:140607790-140607812 GAGTGAAGAACAGGTAACTCAGG + Intergenic
982118828 4:152119530-152119552 CAGTGAACATCAGGTCACTTGGG + Intergenic
982560461 4:156923233-156923255 GAGTGAGGACCAGGTCAGCCTGG - Intronic
983706976 4:170673595-170673617 CAGTGATTAGCAGGTCAATGTGG - Intergenic
985935740 5:3096537-3096559 CAGTGAGAAGGGGGTCACCCTGG - Intergenic
986311266 5:6552765-6552787 CAATGTGGAGCAGGTTTCTCTGG + Intergenic
986803049 5:11281218-11281240 CAGAGAGGATAAGGTCACTGAGG + Intronic
986920582 5:12674464-12674486 CAGTGAGGAACAGTGCACTCCGG - Intergenic
989423152 5:41264290-41264312 AAGTCAGGACCACGTCACTCTGG - Intergenic
995487108 5:112650372-112650394 CTGGGAGGAGAAGGGCACTCTGG - Intergenic
995742463 5:115369142-115369164 CAGAGAGGAGCTGCTCACTGTGG + Intergenic
995850923 5:116545103-116545125 CAGTTAGGAACAGGTAACTAAGG - Intronic
999237869 5:150110097-150110119 CAGGATGGAGCAGGTGACTCAGG - Intronic
1003219122 6:4141740-4141762 CAGTGAAGAGCATGTGCCTCAGG + Intergenic
1004356132 6:14931460-14931482 CAGTGAGGAGCAACTCACAGGGG + Intergenic
1004761495 6:18671576-18671598 CAATGAGGAAAAGATCACTCTGG - Intergenic
1004876989 6:19966127-19966149 CAGTGTGGTGCAGCTCACGCTGG - Intergenic
1005560733 6:27037717-27037739 CAGTCAGAAGCAGGTCAATACGG - Intergenic
1007322588 6:41038385-41038407 CAGTGAGGTGCACCTCACTGGGG - Intronic
1010551749 6:77231874-77231896 CACTCAGGAGCAAGTCACTGAGG + Intergenic
1010844313 6:80686080-80686102 CATTCAGGAGCAGGTTATTCAGG - Intergenic
1011515643 6:88149611-88149633 CAAAGAGCAGCAAGTCACTCAGG - Intronic
1013428457 6:110035321-110035343 CAGTGAGGACTGGGTCACCCAGG - Intergenic
1013496253 6:110700523-110700545 CACTGAGGAACAGGTCAGTAAGG + Intronic
1014153214 6:118082859-118082881 CAGGGATGAGCAGGTGATTCAGG - Intronic
1014380411 6:120733664-120733686 CTCTGTGAAGCAGGTCACTCAGG + Intergenic
1016241811 6:141940037-141940059 CTGTGAGGAACAGTGCACTCCGG + Intergenic
1016506152 6:144781977-144781999 CACTGAGGAGCTGGTCATTTTGG - Exonic
1017205160 6:151797087-151797109 AAGTGAAGAGCATGTCACTGGGG + Intronic
1017940556 6:159049135-159049157 CAGTGAGGAGCATGGCTCTGGGG - Intergenic
1017968765 6:159290732-159290754 CTGTGAGGAACAGTGCACTCTGG - Intergenic
1019491386 7:1315088-1315110 CAGTGAGGCGCTGGGCCCTCGGG - Intergenic
1020391475 7:7662511-7662533 CGGTGAGGAACAGTGCACTCCGG - Intronic
1022328959 7:29359920-29359942 CCCTGGGCAGCAGGTCACTCAGG + Intronic
1023340359 7:39213040-39213062 CAGTGATTAGTAGGTCATTCTGG - Intronic
1024742619 7:52371418-52371440 CAGTGAGAAGCAGATGGCTCTGG - Intergenic
1032604119 7:133330620-133330642 CCGTGAGGAACAGTGCACTCCGG - Intronic
1033637911 7:143229345-143229367 CCGTGGGGAGCAGATAACTCAGG + Intergenic
1034547156 7:151796665-151796687 CTGGGAGGAGCCGGTGACTCAGG - Intronic
1035370940 7:158378508-158378530 CTGTGGGGAGCAGCTCACTGTGG - Intronic
1037677169 8:21061004-21061026 AAGTGTGGAGCAGGGCACACTGG - Intergenic
1038360696 8:26873014-26873036 CAATGATGTGCAGGTCACCCAGG + Intergenic
1038701061 8:29849690-29849712 CAGTGTGGAGCAGGTAACCCGGG - Intergenic
1040104651 8:43534839-43534861 CAGTGGGGACCAGGTCAGTGAGG + Intergenic
1041555533 8:59150361-59150383 CAGAGAGGAGCAGGTATCACAGG - Intergenic
1041838392 8:62242433-62242455 CCCTGAGGAGCAGTGCACTCTGG - Intergenic
1042902721 8:73745891-73745913 CATTGAGAAGCACGCCACTCTGG - Intronic
1049454528 8:142680345-142680367 GAGGGAGGTGCAGGTCGCTCAGG + Intronic
1051863449 9:21652048-21652070 CCGTGAGGAACAGTGCACTCTGG - Intergenic
1056611228 9:88127310-88127332 CAGTGAGGACCTGGTCAGTGAGG + Intergenic
1056913575 9:90725646-90725668 CAGTGTGGAGCAGGTGACCATGG - Intergenic
1057839588 9:98474921-98474943 CAGTGTGGAGCAGCTCATTGGGG + Intronic
1059232343 9:112732814-112732836 CAGAGAGGAGCTGCCCACTCTGG - Intergenic
1059402162 9:114077292-114077314 CAATGAGGAGCAGGTCCCTGTGG - Intronic
1060394640 9:123306911-123306933 CTGTGAGTTGCAGGTCTCTCAGG - Intergenic
1060790130 9:126480372-126480394 CATTGAGGAACAGGTCACACTGG - Intronic
1060974065 9:127754644-127754666 GAGTGAGGAGCAGGAAACGCGGG - Intronic
1061821594 9:133230603-133230625 CAGTGAAGTGCAGATCACCCAGG + Intergenic
1061905047 9:133692446-133692468 CAGCGATGGGCAGGTCACACTGG + Intronic
1062145513 9:134987567-134987589 CAGTGAGAAGTAACTCACTCGGG + Intergenic
1062282960 9:135760121-135760143 CTGGGAGGGGCAGGTCACCCTGG - Intronic
1062523968 9:136970848-136970870 GAGTGGGGAGCAGGACCCTCCGG + Intronic
1062629174 9:137456000-137456022 CAGAGAGGAGCAGGTCCCTGCGG + Intronic
1185692465 X:2167506-2167528 CAGTAAGGAACAGGGCACACAGG - Intergenic
1189590588 X:42506969-42506991 CTGTGAGGAACAGTGCACTCTGG + Intergenic
1190280466 X:48925912-48925934 CATCGAGGAGCAGGTGGCTCGGG - Exonic
1190567743 X:51748040-51748062 CAGTGAGAAGCAGATCATCCAGG + Intergenic
1191206665 X:57842023-57842045 CCGTGAGGAACAGTGCACTCTGG + Intergenic
1192009196 X:67250161-67250183 CTGTGAGGAACAGTGCACTCAGG + Intergenic
1192524488 X:71829909-71829931 CTGTGAGGAACAGTGCACTCTGG + Intergenic
1193058011 X:77175322-77175344 CTGGGAGGAGCTTGTCACTCTGG - Intergenic
1194783185 X:98049552-98049574 CCGTGAGGAACAGCGCACTCCGG - Intergenic
1195688240 X:107604022-107604044 CAGTGAGGGGCAGGGCACTTTGG - Exonic
1197191035 X:123648251-123648273 CAGTGAGGAACAGTGCATTCTGG + Intronic
1197403689 X:126025535-126025557 CAGTGAGGAACGGTGCACTCTGG + Intergenic
1198082825 X:133255138-133255160 CAGAAAGGAGCAGGTCTGTCCGG - Intergenic
1198981259 X:142399113-142399135 CTCTGAGGAGCAGGCCACTAGGG + Intergenic
1199094418 X:143723418-143723440 CTGTGAGGAACAGTGCACTCTGG + Intergenic