ID: 935735304

View in Genome Browser
Species Human (GRCh38)
Location 2:106101986-106102008
Sequence AGTGAGGAGCAGGTCACTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 221}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935735299_935735304 -9 Left 935735299 2:106101972-106101994 CCTCCATCGTTACCAGTGAGGAG 0: 1
1: 0
2: 0
3: 2
4: 78
Right 935735304 2:106101986-106102008 AGTGAGGAGCAGGTCACTCTGGG 0: 1
1: 0
2: 1
3: 20
4: 221
935735294_935735304 7 Left 935735294 2:106101956-106101978 CCCTTCTCCTTCTCCTCCTCCAT 0: 1
1: 10
2: 128
3: 790
4: 3989
Right 935735304 2:106101986-106102008 AGTGAGGAGCAGGTCACTCTGGG 0: 1
1: 0
2: 1
3: 20
4: 221
935735297_935735304 -6 Left 935735297 2:106101969-106101991 CCTCCTCCATCGTTACCAGTGAG 0: 1
1: 0
2: 0
3: 6
4: 83
Right 935735304 2:106101986-106102008 AGTGAGGAGCAGGTCACTCTGGG 0: 1
1: 0
2: 1
3: 20
4: 221
935735296_935735304 0 Left 935735296 2:106101963-106101985 CCTTCTCCTCCTCCATCGTTACC 0: 1
1: 0
2: 5
3: 56
4: 742
Right 935735304 2:106101986-106102008 AGTGAGGAGCAGGTCACTCTGGG 0: 1
1: 0
2: 1
3: 20
4: 221
935735295_935735304 6 Left 935735295 2:106101957-106101979 CCTTCTCCTTCTCCTCCTCCATC 0: 2
1: 50
2: 1080
3: 3327
4: 13841
Right 935735304 2:106101986-106102008 AGTGAGGAGCAGGTCACTCTGGG 0: 1
1: 0
2: 1
3: 20
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935735304 Original CRISPR AGTGAGGAGCAGGTCACTCT GGG Intronic
900333794 1:2150686-2150708 TCTGAGGAGCAGGTCTCTGTTGG + Intronic
900556845 1:3284943-3284965 AGAGGGGAGCAGGTCACTCAGGG - Intronic
900584989 1:3428400-3428422 TGTGAGAAGCAGGGCACTGTGGG - Intronic
902211755 1:14909626-14909648 GTTGAAGAGCAGGGCACTCTGGG - Intronic
902982821 1:20138086-20138108 AGGCAGGAGAAGGTGACTCTTGG - Intergenic
903358961 1:22765099-22765121 GGTGAGGAGCCGGACATTCTGGG + Intronic
903968783 1:27105924-27105946 AGTGAGGAACAGGTCACACATGG + Exonic
905546124 1:38801747-38801769 AGAGAGGAGCAACCCACTCTAGG + Intergenic
905638342 1:39571113-39571135 AGGTAGGAGCAGGCCACACTTGG + Intronic
906065988 1:42980431-42980453 AGCCAGGAGCAGGACACCCTTGG - Intergenic
907152995 1:52306340-52306362 AGAGAGGAGCTGCTCACTCCAGG + Intronic
910259903 1:85284521-85284543 AGAGAGGAGCTGCCCACTCTAGG + Intergenic
912566775 1:110593102-110593124 AGTGAGGAGAATGTCTATCTTGG - Intergenic
913648939 1:120890970-120890992 AGTGGCCAGCAGGTCACTATTGG - Intergenic
914077754 1:144372413-144372435 AGTGGCCAGCAGGTCACTATTGG + Intergenic
914101425 1:144594092-144594114 AGTGGCCAGCAGGTCACTATTGG - Intergenic
914172663 1:145240953-145240975 AGTGGCCAGCAGGTCACTATTGG + Intergenic
914297552 1:146343544-146343566 AGTGGCCAGCAGGTCACTATTGG + Intergenic
914527318 1:148482086-148482108 AGTGGCCAGCAGGTCACTATTGG + Exonic
914639077 1:149585047-149585069 AGTGGCCAGCAGGTCACTATTGG - Intergenic
915266169 1:154719619-154719641 AGTGATGATCAGATCACTATCGG + Intronic
916602362 1:166305592-166305614 AGTGAGCAGCTGGTCAAGCTGGG + Intergenic
916855172 1:168741744-168741766 AGTGAGGGGCAGGGAGCTCTTGG + Intergenic
917831603 1:178895774-178895796 AATGGGGGGCAGGTCAGTCTTGG + Intronic
918102380 1:181387541-181387563 ACTGAGGAGCAGCTCTCCCTTGG - Intergenic
920346435 1:205308766-205308788 AGTGGAGAGCAGTGCACTCTGGG - Intronic
920998523 1:211018110-211018132 ATTTAGGACCAGGTCACTCATGG - Intronic
921348261 1:214209174-214209196 AGTGAGGACCAGGACACTTTAGG - Intergenic
921813071 1:219536404-219536426 GCTGAGTAGCAGGTCCCTCTAGG - Intergenic
921859173 1:220023070-220023092 AATGAGAAGCAGGATACTCTTGG + Intronic
1063418096 10:5889853-5889875 CGTGCGGGGCAGGTCACGCTTGG - Exonic
1064070255 10:12222852-12222874 AGTGATGAGCATGTCGGTCTGGG - Intronic
1067457244 10:46427819-46427841 ATTCAGGAGCAGGGCACTCAGGG - Intergenic
1067629958 10:47956819-47956841 ATTCAGGAGCAGGGCACTCAGGG + Intergenic
1069623534 10:69852716-69852738 AGTGACCTGCAGGCCACTCTTGG - Intronic
1070425814 10:76286055-76286077 GGTGTACAGCAGGTCACTCTGGG + Intronic
1071886033 10:89951699-89951721 AGAGAGGAGCAACTCACTCTAGG - Intergenic
1071971837 10:90915760-90915782 AGTGAGTAGCTGGACACGCTCGG - Exonic
1072590855 10:96827363-96827385 ACTGTGGAGCAGCTGACTCTGGG - Intergenic
1073180100 10:101578340-101578362 AGACAGGAGCAGGTCCCGCTGGG - Intronic
1074028796 10:109663929-109663951 AGAGAGGAGCAACCCACTCTAGG + Intergenic
1076067121 10:127457749-127457771 AGTGAGGACTAGGTCATTCATGG - Intergenic
1076637813 10:131893799-131893821 AGACAGGAGCAGGTGACTGTGGG + Intergenic
1077805455 11:5587565-5587587 AGGGATGAGAAGGTCTCTCTTGG + Intronic
1078524039 11:12087003-12087025 AGGGTGGAGCAGGGCACACTTGG - Intergenic
1078858529 11:15226267-15226289 AGAGGGGAGCAGTTCACTATAGG - Intronic
1087784894 11:102343462-102343484 AGTGAGGATCCCGCCACTCTGGG + Intergenic
1089104650 11:115992302-115992324 AGTGTGAAGCAGTTCTCTCTAGG - Intergenic
1091352715 11:134910156-134910178 AGTATTGAGCAGGTCACTTTTGG - Intergenic
1092263732 12:6965759-6965781 TGTGAGAGGCAGGACACTCTAGG + Intronic
1097130855 12:56809937-56809959 AGAGAGGAGCAACCCACTCTAGG - Intergenic
1098424726 12:70349087-70349109 ATTAATGAGCAGCTCACTCTTGG + Intronic
1098597819 12:72294505-72294527 AGAGAGGAGCAACACACTCTAGG - Intronic
1100368120 12:93940453-93940475 AGTGAGTGGCAGTTCAGTCTGGG + Intergenic
1104160363 12:126173470-126173492 AGTGGGGTGGAGGTGACTCTGGG + Intergenic
1104971704 12:132533770-132533792 TGTGAGGAGCACGTCACACAGGG + Intronic
1105048574 12:133027748-133027770 AGAGAGGAGCCAGTCACTCTAGG + Intergenic
1105847630 13:24307611-24307633 TGGGAGGAGCAGATCACTTTGGG - Intronic
1105973662 13:25454120-25454142 ACTGTGGAGCATGTCACTCAGGG + Intronic
1106506658 13:30376363-30376385 GGTTAGGGGGAGGTCACTCTGGG + Intergenic
1106707347 13:32295396-32295418 AGTGAGGACTCGGTAACTCTGGG - Exonic
1108583091 13:51844313-51844335 TGTGAGGACCAACTCACTCTTGG + Intergenic
1109798557 13:67346039-67346061 AGGGAGGAGCAAGCCACTCCAGG + Intergenic
1116624902 14:47252011-47252033 GGTGAGGGAAAGGTCACTCTGGG - Intronic
1119105171 14:71916744-71916766 AGTGAGGAGCTGGTCCGTGTCGG + Intergenic
1119226133 14:72945891-72945913 TGTGAAGAGCCGGTCACTGTTGG - Exonic
1119762013 14:77158284-77158306 AGTGAGGAGCAGGCCAAGCAGGG + Intronic
1119986850 14:79148000-79148022 AATGAGGAGAAGGTCACTGCTGG - Intronic
1120905083 14:89613192-89613214 AGAGAGTAGCAGGTCCCACTTGG - Intronic
1121717704 14:96088038-96088060 AGTGAGGAGAAAGCCTCTCTGGG - Exonic
1123010871 14:105348950-105348972 AGAGGGGAGCAGGGCACTCTGGG + Intronic
1124997117 15:34734566-34734588 AGAGAGGAGCGGGTCAGTATGGG + Intergenic
1125967645 15:43887197-43887219 AGTGTGGAGCAGGCCCCTGTCGG + Intronic
1126725086 15:51623138-51623160 AGTGGGGTGCAGGTCGCTCGGGG + Intergenic
1127816044 15:62609696-62609718 AGTGAGGAGCTGGGCACCATCGG - Intronic
1128847889 15:70917522-70917544 AGAGAGGAGCAACTCACTCTAGG + Intronic
1129609982 15:77045312-77045334 AGTGGGCAGCAGGGCACTGTTGG - Exonic
1132883899 16:2174002-2174024 ACTGAAGAGCAGGTCACCCATGG - Exonic
1134642815 16:15842953-15842975 AGTCAGGGGCAGGACACTGTTGG - Intronic
1136777344 16:32879022-32879044 GGGGATGAGCAGGTGACTCTGGG - Intergenic
1136893281 16:33982491-33982513 GGGGATGAGCAGGTGACTCTGGG + Intergenic
1136999509 16:35216751-35216773 AATGGCGAGCAGGTCACTGTGGG + Intergenic
1137003441 16:35251255-35251277 AATGGCGAGCAGGTCACTGTGGG - Intergenic
1137508511 16:49077727-49077749 AGGGAGGGGCAGATCAGTCTGGG + Intergenic
1137803537 16:51283195-51283217 ACTGAGGAGCAGTTCACTGAGGG - Intergenic
1140820306 16:78657148-78657170 AGTGATGAGCAGGACACATTGGG - Intronic
1141106088 16:81234954-81234976 AGTGAGGAGCAGCTCAAATTAGG - Intergenic
1203079757 16_KI270728v1_random:1141131-1141153 GGGGATGAGCAGGTGACTCTGGG - Intergenic
1142567458 17:849920-849942 TTTCAGGAGCAGGTCGCTCTCGG - Intronic
1142714147 17:1738834-1738856 AGTGAGGAGCAGGACAGTGAGGG + Intergenic
1142714259 17:1739329-1739351 AGTGAGGAGCAGGACAGTGAGGG + Intergenic
1142714280 17:1739419-1739441 AGTGAGGAGCAGGACAGTGAGGG + Intergenic
1142714330 17:1739642-1739664 AGTGAGGAGCAGGACAGTGAGGG + Intergenic
1142714394 17:1739912-1739934 AGTGAGGAGCAGGACAGTGAGGG + Intergenic
1142714437 17:1740092-1740114 AGTGAGGAGCAGGACAGTGAGGG + Intergenic
1142714521 17:1740452-1740474 AGTGAGGAGCAGGACAGTGAGGG + Intergenic
1142714575 17:1740677-1740699 AGTGAGGAGCAGGACAGTCAGGG + Intergenic
1142714685 17:1741127-1741149 AGTGAGGAGCCGGACACTGAGGG + Intergenic
1142714760 17:1741442-1741464 AGTGAGGAGCAGGACAGTGAAGG + Intergenic
1142714790 17:1741577-1741599 AGTGAGGAGCAGGACAGTGAGGG + Intergenic
1142714810 17:1741667-1741689 AGTGAGGAGCAGGACAGTGAGGG + Intergenic
1142714833 17:1741757-1741779 AGTGAGGAGCAGGACAGTGAGGG + Intergenic
1142714886 17:1741980-1742002 AGTGAGGAGCAGGACAGTGAGGG + Intergenic
1142714898 17:1742025-1742047 AGTGAGGAGCAGGACAGTGAGGG + Intergenic
1142801981 17:2352034-2352056 AGAGAGGGGCAGGTCACACTTGG + Intronic
1145295895 17:21592641-21592663 AGCGAGGTGCAGGCCACCCTTGG - Intergenic
1145367890 17:22279421-22279443 AGCGAGGTGCAGGCCACCCTTGG + Intergenic
1146523684 17:33547621-33547643 AGTGGGTTGGAGGTCACTCTAGG - Intronic
1147913789 17:43874589-43874611 AGGGAGGAGCAGGTAACCTTTGG - Intergenic
1150008006 17:61481567-61481589 GGAGAGGAGCAGGTCTCCCTGGG + Intronic
1150482672 17:65522676-65522698 CCTGAGCAGCAGGTCACTTTAGG + Intergenic
1150676204 17:67246852-67246874 GGTGAGAAGCAGGTGACTCAGGG - Intergenic
1151670364 17:75568815-75568837 TGTGAGCAGCAGGTCCCTCTGGG - Exonic
1154056008 18:11014448-11014470 AGTGGGGAACATGTCACCCTGGG + Intronic
1154056038 18:11014558-11014580 AGTGGGGAACATGTCACCCTGGG + Intronic
1154056054 18:11014612-11014634 AGTGGGGAACACGTCACTCTGGG + Intronic
1154056067 18:11014667-11014689 AGTGGGGAACATGTCACCCTGGG + Intronic
1154056101 18:11014778-11014800 AGTGGGGAACATGTCACCCTGGG + Intronic
1154330393 18:13424735-13424757 AATGAGGAGCAAGTCATTCTAGG + Intronic
1158046947 18:53167939-53167961 AGTCAGGAGAAGGTAACTCCAGG + Intronic
1158608984 18:58921600-58921622 AGTGAAGTGCAGGTCAATGTTGG + Intronic
1160736559 19:665326-665348 AGCGAGGGGCAGGTGACTCGGGG - Intergenic
1161697145 19:5775693-5775715 AGGGAGGAGCAGGTAACGATTGG + Intronic
1162177269 19:8840267-8840289 AATGAGGCTCAGATCACTCTTGG + Intronic
1163754840 19:19100572-19100594 GATGAGGTGCAGGTCACTTTGGG - Intronic
1166321855 19:42023628-42023650 AGTGAGGAGAAGGCCAGTGTGGG - Intronic
926720804 2:15958789-15958811 GGTGGGGAGCAGGGCACACTCGG - Intergenic
928083899 2:28333726-28333748 AGTGAGGAGCTTGACACTCAGGG + Intronic
928437102 2:31261776-31261798 AGTATGGAGGAGGCCACTCTTGG + Intronic
930307595 2:49694746-49694768 AGTGGTGACCTGGTCACTCTGGG - Intergenic
931409786 2:62018280-62018302 AGTGAGGAGCAGTTCACCAAAGG + Intronic
935384613 2:102487325-102487347 AGTGAGGAGCAGATCAGTGCAGG + Intronic
935735304 2:106101986-106102008 AGTGAGGAGCAGGTCACTCTGGG + Intronic
937236752 2:120435882-120435904 AGTGGACAGAAGGTCACTCTGGG + Intergenic
937921487 2:127134825-127134847 ACTGAGGAGGAGGTCACTGTGGG - Intergenic
938096388 2:128466950-128466972 AGAGAGGAGCTACTCACTCTAGG - Intergenic
943093129 2:183397181-183397203 TGTGAGTATCTGGTCACTCTAGG - Intergenic
945855747 2:215067703-215067725 AGTGAGGAGCCAGCCACTCATGG + Intronic
945954236 2:216070741-216070763 AGGGAGGAGCAGGTAACATTTGG + Intronic
947751830 2:232536702-232536724 GATGAGGAGCAGCTCACTCAAGG - Intergenic
947960320 2:234230903-234230925 ATTGAGGAGAATGTAACTCTGGG - Intergenic
948674288 2:239587957-239587979 AGTGAGGAGAAGGTGACTTCGGG - Intergenic
1171218930 20:23375922-23375944 AATGATGAGTAGGTCAGTCTAGG - Exonic
1172397497 20:34619305-34619327 ACTCAGAACCAGGTCACTCTGGG + Intronic
1173122648 20:40307837-40307859 AGTGAGAAACAGGAGACTCTGGG + Intergenic
1174873370 20:54204091-54204113 GGTGTGGAGCTGGTCACTGTGGG - Intergenic
1175267536 20:57711558-57711580 TGGGAGGAGAAGCTCACTCTTGG + Intergenic
1175698991 20:61123763-61123785 AGTGTGGAGAAGGGCACTCAGGG + Intergenic
1180125818 21:45789671-45789693 GGTGAGGAGCAGGTCATTTGTGG + Intronic
1181861978 22:25826173-25826195 AGTGATGAGCAGATCACTCTGGG + Intronic
1182720741 22:32397056-32397078 AGGGAGGAGGAGGTAACTATTGG - Intronic
1183333101 22:37231853-37231875 AGGGAGGAACTGGTGACTCTAGG - Intronic
1183490319 22:38112317-38112339 AGGGAGGAGGGGGTCACCCTAGG + Intronic
1183813651 22:40279916-40279938 ATAGTGGGGCAGGTCACTCTTGG + Intronic
1184677820 22:46053271-46053293 GGTGGGGAGCCGGACACTCTGGG - Intronic
1184691982 22:46121622-46121644 AGGGAGGCCCAGGTCTCTCTAGG + Intergenic
949579234 3:5370577-5370599 AGTGAGTAGAAGGAAACTCTGGG - Intergenic
950213960 3:11144657-11144679 AGGGAGGAGCAGGTCTTCCTGGG + Intronic
950333755 3:12177805-12177827 ACTGAGGGGCAGGTCACTCAAGG - Intronic
950649032 3:14395881-14395903 AGGGAGGTGGAGGTCCCTCTGGG + Intergenic
952878779 3:37970018-37970040 AGTGAGAGGCAGGTCACAGTGGG - Intronic
952960994 3:38589006-38589028 AGGGAGGAACAGTTCCCTCTGGG - Intronic
954147573 3:48641861-48641883 GGTGAGGAGCCTCTCACTCTGGG + Exonic
954335842 3:49916995-49917017 TGTCAGGAGCAGCTTACTCTTGG - Intronic
955065961 3:55533899-55533921 AGCGAGGGGCAGGTCACCCAGGG + Intronic
956840485 3:73135416-73135438 AGTGAGATGCAAGTAACTCTTGG + Intergenic
957545054 3:81626114-81626136 AGTAAGGAGCAGCTCATGCTCGG + Intronic
959016136 3:101135959-101135981 AGTCAGGAGCAGGGTACTCACGG + Intergenic
962695600 3:137944446-137944468 AGTGAGGAGCTTATCACTGTTGG - Intergenic
962824516 3:139088394-139088416 AGAGAGGAGCAACCCACTCTAGG - Intronic
963888085 3:150603284-150603306 AGTGGGGAGCAGCTCGCTCCTGG + Exonic
965813369 3:172614071-172614093 AGAGAGGAGCTATTCACTCTAGG - Intergenic
967459648 3:189730709-189730731 GGTGAGGAGGAGGTCCCTCCAGG + Intronic
968630703 4:1649529-1649551 GGTGAGGACCAGGTCACACAGGG + Intronic
968957012 4:3724664-3724686 AGTGTGGGGCGGGCCACTCTCGG - Intergenic
970966635 4:21935578-21935600 AGGGAACAGGAGGTCACTCTGGG - Intronic
971844218 4:31897621-31897643 TGTGAGGAGCAACTCACTATCGG - Intergenic
972128702 4:35802306-35802328 AGAGAGGAGCAACTCACTCTAGG + Intergenic
972739404 4:41876420-41876442 AGTCAGGAGCTGGTAAATCTAGG + Intergenic
976290516 4:83412849-83412871 AGTATGGGGCAGGACACTCTGGG - Intronic
977008992 4:91611831-91611853 AGAGAGGAGGAGGTAATTCTTGG - Intergenic
981077756 4:140607791-140607813 AGTGAAGAACAGGTAACTCAGGG + Intergenic
982407407 4:155035748-155035770 AGGGAGGGGCTGGTGACTCTTGG + Intergenic
985587355 5:747669-747691 TGTCAGGAGCAGGGCATTCTTGG + Intronic
985601907 5:839761-839783 TGTCAGGAGCAGGGCATTCTTGG + Intronic
986283750 5:6345073-6345095 ACTGGGCAGCATGTCACTCTTGG - Intergenic
986311267 5:6552766-6552788 AATGTGGAGCAGGTTTCTCTGGG + Intergenic
989197563 5:38730699-38730721 AGGCAGGAGCAGGACCCTCTGGG - Intergenic
989423151 5:41264289-41264311 AGTCAGGACCACGTCACTCTGGG - Intergenic
990992459 5:61699349-61699371 GGTGAGGAGGAGTTAACTCTGGG - Intronic
995742464 5:115369143-115369165 AGAGAGGAGCTGCTCACTGTGGG + Intergenic
995744949 5:115393586-115393608 AGAGAGGAGCAACTCACTCCAGG - Intergenic
998733268 5:145105891-145105913 AGTGAAAAGCAGAGCACTCTGGG - Intergenic
1000426231 5:161093913-161093935 AGAGAGGAGCTATTCACTCTAGG + Intergenic
1000646141 5:163762595-163762617 AGTGAGGGTAAGGTCATTCTGGG + Intergenic
1002054163 5:176589297-176589319 CGGGAGGCGCAGGTCAGTCTTGG - Intronic
1004761494 6:18671575-18671597 AATGAGGAAAAGATCACTCTGGG - Intergenic
1005363649 6:25056031-25056053 AGTGAAGAGAAGGGCATTCTTGG + Intergenic
1007649988 6:43413281-43413303 AGAGAGGAGCAACTCACTCCAGG + Intergenic
1007761027 6:44133817-44133839 AGGCAGGAGCATGGCACTCTGGG + Intronic
1011559208 6:88598156-88598178 AGTGAGAGCCAGCTCACTCTTGG + Intergenic
1013612835 6:111811135-111811157 AGTCAGGAGCTGTTAACTCTAGG + Intronic
1020391717 7:7665642-7665664 AGGGAGTAGCAGGAAACTCTTGG - Intronic
1021584860 7:22197161-22197183 AGTGATGATGAGGTCACTTTAGG + Intronic
1023257096 7:38322892-38322914 AGTTTGAAACAGGTCACTCTGGG - Intergenic
1023365439 7:39458819-39458841 AGGGAGGAGCAGGGCACCGTAGG - Intronic
1024636259 7:51292820-51292842 AAAGAGGAGCAGGGCCCTCTAGG + Intronic
1025635704 7:63317730-63317752 TGTGAGGAGCAGGTGGCTCACGG + Intergenic
1025646992 7:63430450-63430472 TGTGAGGAGCAGGTGGCTCACGG - Intergenic
1027541331 7:79470349-79470371 AGTGAGAAGGAGGTCATTCTAGG - Intergenic
1028002319 7:85514833-85514855 AGTGAGGAGGAAGTTAGTCTAGG - Intergenic
1028341834 7:89731812-89731834 AGGGAGGAGGAGGTAACTATTGG + Intergenic
1028450072 7:90971940-90971962 AGTCAGCAGCAGGCCACCCTGGG + Intronic
1029228547 7:99047156-99047178 GGCGAGGAGCAGGTGGCTCTTGG - Intronic
1033176483 7:139128555-139128577 AGGGAAGAGAAGGTCAGTCTGGG - Intergenic
1033629372 7:143141666-143141688 AGTTAGGAGCATGTCTCTCCAGG - Intergenic
1034481284 7:151321803-151321825 AGAGAGGAGCAACCCACTCTAGG + Intergenic
1035370939 7:158378507-158378529 TGTGGGGAGCAGCTCACTGTGGG - Intronic
1036592643 8:10182876-10182898 AGTGAGAAGCAAGTTACTCAAGG + Intronic
1037354566 8:18003445-18003467 AAAGAGGAGAAGGTCATTCTAGG - Intronic
1041752814 8:61279269-61279291 AGTGAGGCGAAGGCCATTCTTGG + Intronic
1042902720 8:73745890-73745912 ATTGAGAAGCACGCCACTCTGGG - Intronic
1044524940 8:93241464-93241486 AGAGAGGAGCAACTCACTCTAGG - Intergenic
1045720087 8:105098946-105098968 AGAGAGGGGAAGTTCACTCTAGG - Intronic
1046731581 8:117731848-117731870 CGAGAGGAGGAAGTCACTCTGGG + Intergenic
1048359997 8:133689520-133689542 AGTGACATGCAGGTCACTCTTGG + Intergenic
1048495826 8:134935293-134935315 AGGGAGCAGGAGGACACTCTTGG + Intergenic
1049454529 8:142680346-142680368 AGGGAGGTGCAGGTCGCTCAGGG + Intronic
1049538478 8:143194272-143194294 AGGGAGCAGCAGGTCACCCAAGG - Intergenic
1050601962 9:7261938-7261960 AGTTAGGAGGAAGTAACTCTAGG + Intergenic
1050701235 9:8341645-8341667 ATTCAGGAGCAAGTCATTCTGGG - Intronic
1056253570 9:84775210-84775232 GGAGAGGAGCAGGTGCCTCTAGG - Intronic
1058690691 9:107518037-107518059 AGGGAGGACCAGGGCACTCCAGG - Intergenic
1059232342 9:112732813-112732835 AGAGAGGAGCTGCCCACTCTGGG - Intergenic
1060482285 9:124023648-124023670 AGTGAGGAGCCAGTCTCTGTTGG + Intronic
1060974064 9:127754643-127754665 AGTGAGGAGCAGGAAACGCGGGG - Intronic
1062523969 9:136970849-136970871 AGTGGGGAGCAGGACCCTCCGGG + Intronic
1062629175 9:137456001-137456023 AGAGAGGAGCAGGTCCCTGCGGG + Intronic
1186876180 X:13820357-13820379 AGTGAGGAGATGGTCATGCTGGG + Intronic
1193108435 X:77704291-77704313 AGAGAGGAGCAACCCACTCTAGG - Intronic
1195688239 X:107604021-107604043 AGTGAGGGGCAGGGCACTTTGGG - Exonic
1197990332 X:132310723-132310745 AGAGAGCAGCAAGTGACTCTCGG + Intergenic
1198532141 X:137557872-137557894 AGTGAGGAAAAGGACACTGTAGG + Intergenic