ID: 935735305

View in Genome Browser
Species Human (GRCh38)
Location 2:106101991-106102013
Sequence GGAGCAGGTCACTCTGGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 274}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935735296_935735305 5 Left 935735296 2:106101963-106101985 CCTTCTCCTCCTCCATCGTTACC 0: 1
1: 0
2: 5
3: 56
4: 742
Right 935735305 2:106101991-106102013 GGAGCAGGTCACTCTGGGTCAGG 0: 1
1: 0
2: 2
3: 10
4: 274
935735299_935735305 -4 Left 935735299 2:106101972-106101994 CCTCCATCGTTACCAGTGAGGAG 0: 1
1: 0
2: 0
3: 2
4: 78
Right 935735305 2:106101991-106102013 GGAGCAGGTCACTCTGGGTCAGG 0: 1
1: 0
2: 2
3: 10
4: 274
935735297_935735305 -1 Left 935735297 2:106101969-106101991 CCTCCTCCATCGTTACCAGTGAG 0: 1
1: 0
2: 0
3: 6
4: 83
Right 935735305 2:106101991-106102013 GGAGCAGGTCACTCTGGGTCAGG 0: 1
1: 0
2: 2
3: 10
4: 274
935735300_935735305 -7 Left 935735300 2:106101975-106101997 CCATCGTTACCAGTGAGGAGCAG 0: 1
1: 0
2: 0
3: 9
4: 100
Right 935735305 2:106101991-106102013 GGAGCAGGTCACTCTGGGTCAGG 0: 1
1: 0
2: 2
3: 10
4: 274
935735295_935735305 11 Left 935735295 2:106101957-106101979 CCTTCTCCTTCTCCTCCTCCATC 0: 2
1: 50
2: 1080
3: 3327
4: 13841
Right 935735305 2:106101991-106102013 GGAGCAGGTCACTCTGGGTCAGG 0: 1
1: 0
2: 2
3: 10
4: 274
935735294_935735305 12 Left 935735294 2:106101956-106101978 CCCTTCTCCTTCTCCTCCTCCAT 0: 1
1: 10
2: 128
3: 790
4: 3989
Right 935735305 2:106101991-106102013 GGAGCAGGTCACTCTGGGTCAGG 0: 1
1: 0
2: 2
3: 10
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935735305 Original CRISPR GGAGCAGGTCACTCTGGGTC AGG Intronic
900552040 1:3261694-3261716 GGAGGAGGTCCCTGGGGGTCTGG - Intronic
900644940 1:3704739-3704761 GGAGCCGGGGACTCTGGGGCGGG + Intronic
901139322 1:7018176-7018198 GGTTCAGGTCACTCTGGGGATGG + Intronic
902441991 1:16436536-16436558 GGGGCAGATCACTCGAGGTCAGG + Intronic
903284520 1:22268475-22268497 GGAGGTGGCCACTCTGGGGCAGG + Intergenic
904598934 1:31663268-31663290 GGAGCAGTTCCCTCTGGCTGGGG + Intronic
905012017 1:34754313-34754335 TCAGCAGGTCACTTGGGGTCAGG - Intronic
905277027 1:36825007-36825029 GGAGGAGGTCACTATGGGACAGG - Intronic
906948406 1:50315322-50315344 GGAGGAGGCCAGTCAGGGTCAGG + Intergenic
907809713 1:57856533-57856555 CGAGCAGGTCACCTTAGGTCAGG + Intronic
910707122 1:90141570-90141592 GGAGCAGATCACTTGAGGTCAGG + Intergenic
911404179 1:97415547-97415569 TGAGCAGATCACTTGGGGTCAGG - Intronic
913962884 1:143353422-143353444 TGTGCCGGTCACTCTGTGTCTGG - Intergenic
914057239 1:144179007-144179029 TGTGCCGGTCACTCTGTGTCTGG - Intergenic
914121907 1:144787359-144787381 TGTGCCGGTCACTCTGTGTCTGG + Intergenic
914932897 1:151950431-151950453 GCAGCTGGACACTCTGGGCCAGG - Intergenic
915223906 1:154397439-154397461 TGAGCAGGTCACTTGAGGTCAGG - Intergenic
915914136 1:159931122-159931144 GGAGCAGGTCACTCACAGTGGGG + Exonic
918172356 1:182010453-182010475 TGGGCAGATCACTCGGGGTCAGG - Intergenic
919991223 1:202709738-202709760 GGAGCCGGAGACCCTGGGTCAGG - Intronic
920218735 1:204379742-204379764 GGATCAGATCACTTTAGGTCAGG - Intergenic
920304590 1:205010362-205010384 TGAGCAGGTCACTTAAGGTCAGG + Intronic
921284619 1:213597916-213597938 GGAGCCGCTCACTCTGAGTCAGG - Intergenic
922462094 1:225821471-225821493 CGAGCAGATCACTTTAGGTCAGG - Intronic
922503308 1:226111979-226112001 GAAGCAGGGCACTTTGGGTATGG - Intergenic
922743718 1:228031181-228031203 GGCACTGGTCACTGTGGGTCTGG + Intronic
924801312 1:247331331-247331353 GGAGAAGGTCGCTGTGGGCCAGG + Intronic
1064456881 10:15495965-15495987 GGAGCAGATCACTTGAGGTCAGG + Intergenic
1064954107 10:20887696-20887718 GGGGCTGGACACTCTGGCTCAGG - Intronic
1067234926 10:44439379-44439401 GGAGCACGGCACTCTGGGTCTGG - Intergenic
1067734656 10:48840230-48840252 GGGGAAGGTCATTCTGGGTGTGG - Intronic
1068396142 10:56465156-56465178 GGAGCCGGTCACGGTGGCTCAGG + Intergenic
1068528188 10:58155046-58155068 GGAGCAGATCACTCGAGGTCAGG - Intergenic
1068955015 10:62814151-62814173 GGTCCAGGTCAGGCTGGGTCTGG + Exonic
1069544293 10:69318112-69318134 GGAGCTGGTGACTCGGGGGCGGG + Intronic
1071147623 10:82593299-82593321 TGAACAGGTCACTGTTGGTCAGG + Intronic
1071490726 10:86134763-86134785 GGACTAGGTGACTCTGGGTCTGG - Intronic
1072663787 10:97379743-97379765 GGCGCAGGTCACACAGGGACTGG + Exonic
1074567395 10:114593017-114593039 GGATGAGGTCACTCTGAGTATGG + Intronic
1075021762 10:118957304-118957326 GTAGCAGGTGGCTCTGGGTTGGG - Intergenic
1075562318 10:123477163-123477185 GAAGCAGGTCTCTCTGGGGAAGG + Intergenic
1075798354 10:125136412-125136434 GGAGCAGGTCAGGCTTGTTCAGG + Intronic
1076159578 10:128233224-128233246 GGAGCAGCTGACTCTGGCCCTGG + Intergenic
1076633228 10:131865472-131865494 TGGGCAGGTCTCTCTGGGCCAGG + Intergenic
1077187662 11:1242711-1242733 GGAGCTGGTGACTGTGGGTGTGG - Exonic
1077356908 11:2122874-2122896 GGAACCTGTCCCTCTGGGTCTGG - Intergenic
1078191457 11:9094939-9094961 GTAGCTGGACACTCTGGGCCAGG + Intronic
1082090987 11:48089812-48089834 GGAACAGGGCAGTCTGGCTCAGG - Intronic
1082780091 11:57280564-57280586 AGAGCAGGTGTCTGTGGGTCTGG - Intergenic
1083766754 11:64844953-64844975 GGCCCAGGTAAGTCTGGGTCTGG - Intergenic
1084013645 11:66366306-66366328 GGAGCAGGACACTTGGGGCCTGG + Intronic
1084958886 11:72705905-72705927 GGCCCAGGTGATTCTGGGTCTGG - Intronic
1084975820 11:72797441-72797463 TGGGCAGGTCACTCGAGGTCAGG + Intergenic
1085308435 11:75501520-75501542 GGAGCAGGTGACTCTGAGCGAGG - Intronic
1085551456 11:77377049-77377071 TGAGCAGGTCACTTGAGGTCAGG + Intronic
1085781543 11:79413445-79413467 GGAGCTGGACTCTCTGTGTCAGG - Intronic
1087794189 11:102438277-102438299 GGAGCAGATCACTTGAGGTCAGG - Intronic
1091174626 11:133546999-133547021 GGAGAAGGCCACACTGGGGCAGG - Intergenic
1092204608 12:6607309-6607331 GCCGCAGGTCGCGCTGGGTCCGG + Exonic
1092372236 12:7926316-7926338 CGAGCAGGTCACTTGAGGTCAGG - Intronic
1096719261 12:53508867-53508889 GGAGCAGGCTACTGTGGGGCTGG + Intronic
1097219321 12:57438011-57438033 CGAGCAGATCACTTGGGGTCAGG - Intronic
1097742742 12:63263292-63263314 GGAGCAGATCACTGGAGGTCAGG + Intergenic
1100934466 12:99647697-99647719 GGGGCAGGTCACAATGGGTAGGG + Intronic
1101305559 12:103524436-103524458 GAAGCAGGTCTCTCTGGTTTTGG - Intergenic
1101611938 12:106300903-106300925 GGAGCAGGTGACCATGAGTCAGG - Intronic
1102656397 12:114485384-114485406 CGGGCAGATCACTCGGGGTCAGG + Intergenic
1104787316 12:131457899-131457921 AGAGCAGGACACAGTGGGTCGGG + Intergenic
1106660977 13:31799437-31799459 GGGGCAGATCACTTGGGGTCAGG - Intronic
1106669488 13:31889328-31889350 TGAGCAGATCACTCCAGGTCAGG - Intergenic
1107525768 13:41229871-41229893 TGGGCAGATCACTCTAGGTCAGG + Intronic
1107849489 13:44556636-44556658 CGAGCAGATCACTTAGGGTCAGG + Intronic
1107943543 13:45396542-45396564 GGGGCAGGTCACTTGAGGTCAGG + Intronic
1110617601 13:77558584-77558606 CGAGCAAGTCACTTGGGGTCAGG + Intronic
1110760771 13:79228115-79228137 GGAGCAGGGCACTCTAGGGTTGG - Intergenic
1112048492 13:95621417-95621439 GGAGCAGGTAGATTTGGGTCAGG + Intronic
1113340499 13:109419447-109419469 TGGGCAGATCACTTTGGGTCTGG - Intergenic
1113932336 13:113974968-113974990 GACGCTGGTCACACTGGGTCAGG + Intergenic
1114134339 14:19830015-19830037 GGATCAGGTCACTCAGTCTCAGG - Intergenic
1114163522 14:20195310-20195332 GGAGCAGATCACTGGAGGTCAGG + Intergenic
1114492737 14:23113563-23113585 GGAGCAGCTCATGCTGAGTCGGG + Intergenic
1114534514 14:23414356-23414378 GGAGCAGGTTTTTCAGGGTCCGG + Intronic
1116055064 14:39853670-39853692 GGAGCAGGTCACTGTGTTTAGGG - Intergenic
1116443400 14:44980451-44980473 GGAGCAGATCACTTGAGGTCAGG + Intronic
1116456608 14:45127032-45127054 GGAGCAGATCACTTGAGGTCAGG - Intronic
1117920760 14:60723648-60723670 GTAGCAGGTCGCTCTGGGGCAGG + Exonic
1118719760 14:68585683-68585705 TGAGCAGGACACCCGGGGTCGGG - Intronic
1119390834 14:74290011-74290033 GGAGCAGGTCAGTCTAGTTCAGG - Exonic
1119455754 14:74754183-74754205 TGACCAGGTTACTCTGAGTCTGG + Intergenic
1122271894 14:100572038-100572060 GGAGCAGGTGCCTCTGGCTGGGG - Intronic
1122693951 14:103543912-103543934 GGCCCAGGTCAGGCTGGGTCCGG + Intergenic
1122801183 14:104230416-104230438 TGACCAGATCTCTCTGGGTCGGG - Intergenic
1123055224 14:105566271-105566293 GGGCCTGGTCACTCTGGGCCTGG + Intergenic
1123079673 14:105686115-105686137 GGGCCTGGTCACTCTGGGCCTGG + Intergenic
1123412948 15:20074214-20074236 GGAGCAGGACACGCAGGGCCTGG - Intergenic
1123522290 15:21081327-21081349 GGAGCAGGACACGCAGGGCCTGG - Intergenic
1124083239 15:26520298-26520320 GGGGCAGGTCACCCAAGGTCAGG + Intergenic
1124358332 15:29015794-29015816 GGAGGAAGTCGCTCTGGGCCAGG + Intronic
1124376448 15:29132059-29132081 GGAGGAGCTGACTCTGGGGCGGG - Intronic
1128507061 15:68280389-68280411 GGAGGATGTCAGTCTGGGTGGGG + Intronic
1130680202 15:85990001-85990023 AGGGCAGGTCATTCTAGGTCAGG + Intergenic
1130687964 15:86055750-86055772 GGTCCAGTTCACTCTGGATCAGG - Intergenic
1131147763 15:90025179-90025201 GGACCCGGTCACCCTGGCTCTGG - Intronic
1131276531 15:90986399-90986421 GGAGCAGATCACTTGAGGTCAGG + Intronic
1134104627 16:11476936-11476958 GGAGCAGGGCACTGAGGGACAGG + Exonic
1134381879 16:13735020-13735042 TGAGCAGATCACTTGGGGTCAGG + Intergenic
1134383635 16:13751348-13751370 GGAGCAGCACAGTCTGGCTCTGG - Intergenic
1135037308 16:19089102-19089124 CGAGCAGATCACTTTGGGCCAGG - Intergenic
1136248020 16:28986187-28986209 GGAGCAGGTCTGGCTGGCTCAGG - Exonic
1136999511 16:35216756-35216778 CGAGCAGGTCACTGTGGGGAAGG + Intergenic
1137003439 16:35251250-35251272 CGAGCAGGTCACTGTGGGGAAGG - Intergenic
1138507843 16:57486907-57486929 AGAGGAGGTCACTGTGGGGCTGG - Intronic
1138515565 16:57533945-57533967 GGGGCAGGTCACGGTGGGACCGG + Intronic
1139126063 16:64079239-64079261 GGAGCAGATCACTTAAGGTCAGG + Intergenic
1139361623 16:66403172-66403194 GGCCGAGGTCACTCTGGGCCTGG + Exonic
1140476793 16:75242982-75243004 GGAGCAGGACACGCAGGGCCTGG - Exonic
1140849357 16:78920278-78920300 TGACCTGGTCACTCTGGGGCAGG + Intronic
1142033301 16:87849017-87849039 GGAGCAGGGCACCCAGGGTGCGG + Intronic
1142209968 16:88804181-88804203 GGCGCAGGGAACTCTGGGACAGG + Intronic
1142324689 16:89406955-89406977 GGAGCAGATCACTTGAGGTCAGG + Intronic
1143557257 17:7669601-7669623 GGAGAATGTCAGTCTGAGTCAGG + Exonic
1144518283 17:15936102-15936124 AGGGCAGGTCACTCAAGGTCAGG - Intergenic
1144847384 17:18226956-18226978 GGTGCAGCTCACTCTGACTCCGG - Intronic
1146026275 17:29323985-29324007 GGGGCAGATCACTTTAGGTCAGG + Intergenic
1150008008 17:61481572-61481594 GGAGCAGGTCTCCCTGGGCAGGG + Intronic
1151670361 17:75568810-75568832 GCAGCAGGTCCCTCTGGGGTGGG - Exonic
1151816659 17:76474522-76474544 GGATCAGGTCAATCTGGGGAAGG + Exonic
1152628394 17:81398828-81398850 GGAGCTGGTCCCGCTGGGGCTGG + Intronic
1152694322 17:81736044-81736066 GGAGCAGCTGACTCGGGGGCCGG - Intergenic
1203183437 17_KI270729v1_random:88776-88798 CGAGCAGGTCACTCTGGGTGTGG - Intergenic
1155333286 18:24739582-24739604 GGAGCAGGTTAACTTGGGTCTGG + Intergenic
1157292939 18:46422934-46422956 GGAAGAGGAAACTCTGGGTCAGG - Intronic
1157500033 18:48183867-48183889 AGGGCAGGTCTCCCTGGGTCTGG - Intronic
1159710382 18:71750896-71750918 GGAGCAGATCACTTGAGGTCAGG + Intronic
1160382610 18:78472202-78472224 GGAGCAGGTGATTATGGGGCAGG - Intergenic
1161094868 19:2384446-2384468 CGAGCAGATCACCCGGGGTCAGG + Intergenic
1163516357 19:17766363-17766385 CGAGCAGGTCACTTGAGGTCAGG - Intronic
1163740685 19:19009956-19009978 GGAGAAGGTCCAACTGGGTCTGG + Exonic
1163749317 19:19066082-19066104 CGAGCAGATCACTTGGGGTCAGG - Intronic
1164745652 19:30610803-30610825 GAAGCAGCTCTCTCTGGGTGTGG - Intronic
1164845636 19:31430328-31430350 GCTGCTGGTCACTCTGGCTCAGG - Intergenic
1165093804 19:33399988-33400010 GGCTCGGGGCACTCTGGGTCTGG + Intronic
1165920227 19:39292840-39292862 GGAGGTGCTCACTCTGAGTCAGG - Intergenic
1166074446 19:40405509-40405531 TGAGCAGGGCAGTCTGGGTAAGG + Intronic
1167124529 19:47540064-47540086 TGGGGACGTCACTCTGGGTCGGG - Intronic
1167154122 19:47727866-47727888 GGAGCAGATCACTTGAGGTCAGG + Intronic
1167415021 19:49365499-49365521 GAAGCAGGTTACCCTGGGGCCGG - Exonic
1167764262 19:51469690-51469712 GGAACATGTCACTCCTGGTCTGG + Intergenic
1168514465 19:57000208-57000230 CGGGCAGGTCACTTTAGGTCAGG + Intergenic
1202696721 1_KI270712v1_random:131680-131702 TGTGCTGGTCACTCTGTGTCTGG - Intergenic
927142011 2:20137139-20137161 GGAGCAGGTCTGTGTGGGCCTGG - Intergenic
927767183 2:25821534-25821556 CGAGCAGATCACTCGAGGTCAGG + Intronic
927866977 2:26595340-26595362 GGAGGAGGTCTATCAGGGTCGGG + Intronic
927984093 2:27395302-27395324 GGAGCAGATCACTTGAGGTCAGG + Intronic
928009611 2:27594899-27594921 CGAGCAGATCACTCGAGGTCAGG + Intronic
928256940 2:29730865-29730887 GGAGAAGGAAGCTCTGGGTCAGG + Intronic
928427801 2:31193093-31193115 GGAGCAGGGCTCTCAGGGTGAGG - Intronic
929220661 2:39461906-39461928 GGAGTGGGTCACTCGAGGTCAGG + Intergenic
929717473 2:44327631-44327653 TGAGCAGGTCACTTGAGGTCAGG + Intronic
929892978 2:45934419-45934441 CGAGCAGGTCACTTGAGGTCAGG + Intronic
931677676 2:64713903-64713925 TGAGCAGGTGGCTCTGGGCCAGG + Intronic
932243191 2:70174078-70174100 TGAGCAGATCACTTGGGGTCAGG + Intronic
932282129 2:70502546-70502568 GTAGCAGATCACTCGAGGTCAGG - Intronic
932556042 2:72825730-72825752 GGGGCAGGCTCCTCTGGGTCGGG - Intronic
934277874 2:91588694-91588716 TGTGCGGGTCACTCTGTGTCTGG - Intergenic
934296293 2:91745458-91745480 GGATCAGGGCACTCTAGGGCTGG + Intergenic
935735305 2:106101991-106102013 GGAGCAGGTCACTCTGGGTCAGG + Intronic
936512500 2:113159466-113159488 GGAGGAGGTCAGTGTGGCTCTGG + Intronic
937256327 2:120558369-120558391 CGAGCAGATCACTTGGGGTCAGG + Intergenic
937353123 2:121180021-121180043 TGAGCAGGTCACTTGAGGTCAGG + Intergenic
938493326 2:131777121-131777143 GGAGCTGGGCACTGTGGGACAGG - Intergenic
942459586 2:176159961-176159983 AGGGGAGGTCGCTCTGGGTCCGG + Intronic
945815525 2:214601028-214601050 GGGGCAGATGACTCTGGATCTGG - Intergenic
947176264 2:227370527-227370549 CGAGCAGATCACTCGAGGTCAGG + Intronic
948661023 2:239506440-239506462 GGCGCGGGCCACTCTAGGTCTGG - Intergenic
1168791738 20:582229-582251 GGAGCAGATCACTTGAGGTCAGG - Intergenic
1170887557 20:20354784-20354806 GGAGGTGGTCACACTGTGTCAGG + Intronic
1172311593 20:33922476-33922498 GGATGAGGTCACTCAGGGTAAGG - Intergenic
1172397498 20:34619310-34619332 GAACCAGGTCACTCTGGGATAGG + Intronic
1173003269 20:39120913-39120935 GGCACAGGACACTCTGGGACTGG - Intergenic
1173604532 20:44322244-44322266 GCAGCAGATCACTTGGGGTCAGG + Intergenic
1173637937 20:44577359-44577381 CGAGCAGGTCACTTGAGGTCAGG - Intronic
1175860270 20:62146844-62146866 GGGGCAGATCACTTGGGGTCGGG - Intronic
1177030152 21:15972750-15972772 TGAGCAGGTCACTCTATCTCTGG + Intergenic
1179889216 21:44327276-44327298 GGAGCAGGTCACAGTGAGGCAGG - Exonic
1179997361 21:44980223-44980245 GGAGCCCTTCACTCTGGGCCAGG - Intergenic
1180762668 22:18221717-18221739 GGAGCTGGACCCTCTGGGGCGGG - Intergenic
1180772999 22:18402891-18402913 GGAGCTGGACCCTCTGGGGCGGG + Intergenic
1180804357 22:18652446-18652468 GGAGCTGGACCCTCTGGGGCGGG + Intergenic
1180806396 22:18716970-18716992 GGAGCTGGACCCTCTGGGGCGGG - Intergenic
1181217342 22:21342751-21342773 GGAGCTGGACCCTCTGGGGCGGG - Intergenic
1181435490 22:22908073-22908095 GGGCCAGGTCACACTAGGTCAGG + Intergenic
1182201784 22:28579739-28579761 GGAGCAGATCACTTGAGGTCAGG + Intronic
1183276781 22:36903369-36903391 GGAGCAGGTTTCACTGGGTTGGG + Intergenic
1184206841 22:43010095-43010117 GGAGCAGATCACTTCAGGTCAGG - Intronic
1184399226 22:44264143-44264165 GGGGCAGAGCACTCTGGGCCAGG - Intronic
1203234834 22_KI270731v1_random:143879-143901 GGAGCTGGACCCTCTGGGGCGGG + Intergenic
953390857 3:42532921-42532943 GGAGCAGGTCACCATGGGCAGGG + Intronic
954421835 3:50422990-50423012 GAAGCAGCTTACCCTGGGTCTGG - Intronic
955070504 3:55568833-55568855 GGAGCAGGTCAGACTGTGTAGGG - Intronic
957966099 3:87323714-87323736 GCAGCTGGAGACTCTGGGTCAGG + Intergenic
959710499 3:109381152-109381174 GGGGCAGGTCACTTGAGGTCAGG - Intergenic
959850186 3:111076745-111076767 AGGGCAGATCACTTTGGGTCAGG + Intronic
961061349 3:123831746-123831768 GGAGTACATCACTCTGGGACAGG + Intronic
965637147 3:170794098-170794120 TGAGCAGATCACTTGGGGTCAGG - Intronic
967127359 3:186435969-186435991 CGAGCAGATCACTCGAGGTCAGG + Intergenic
967221758 3:187253228-187253250 GGATCAGGACACTGTGGCTCTGG + Exonic
968212987 3:196864932-196864954 GGAGCAGATCACCTTAGGTCAGG - Intergenic
969032869 4:4227641-4227663 TGTGCGGGTCACTCTGTGTCTGG + Intergenic
971849880 4:31970673-31970695 GGGGTAGGTGACTCTGGGACAGG - Intergenic
972494069 4:39616361-39616383 GGAGCAGGTCACTAGAGGCCGGG - Intronic
975837536 4:78440424-78440446 GGGGAAGGTCACTCTGACTCTGG - Intronic
976260515 4:83140817-83140839 GGAGCAGATCACTTGAGGTCAGG + Intergenic
976553559 4:86424415-86424437 GGAGCAGATCACTTGAGGTCAGG - Intronic
976814135 4:89127085-89127107 GGGGCAGATCACTTGGGGTCAGG + Intergenic
979779222 4:124628559-124628581 TGGGCAGATCACTCAGGGTCAGG - Intergenic
982573528 4:157078999-157079021 CGAGCAGATCACCCAGGGTCAGG - Intronic
983080015 4:163373188-163373210 GGAGCAGGACACTCTCTGGCAGG + Intergenic
986249333 5:6042499-6042521 AGAGCAGGTCGCTGTGGGTGGGG + Intergenic
986311280 5:6552868-6552890 GGAGCAGGGTTCTCTGGGACAGG - Intergenic
987957675 5:24762495-24762517 GGAGCAGCTTACACTGGCTCTGG + Intergenic
988024634 5:25669338-25669360 GGAGCAGATCACTTGAGGTCAGG + Intergenic
989197562 5:38730694-38730716 GGAGCAGGACCCTCTGGGACAGG - Intergenic
992675989 5:79106907-79106929 GGAGAAGGGACCTCTGGGTCGGG + Intronic
993506053 5:88709572-88709594 GTAGCAGATCACTTAGGGTCAGG + Intergenic
995747188 5:115416229-115416251 GCAGCAGGTGAGTCTGGGGCAGG + Intergenic
997248827 5:132373406-132373428 GCAGCAGGTCACTTGAGGTCGGG + Intronic
998222941 5:140302825-140302847 GGAGCCGGTTGGTCTGGGTCGGG - Intronic
998443686 5:142182240-142182262 TGAGCAGATCACTTGGGGTCAGG + Intergenic
999230751 5:150060565-150060587 GGAGCCGGATCCTCTGGGTCTGG - Intronic
1002488441 5:179555905-179555927 TGAGCAGGTCACTTGAGGTCAGG - Intronic
1006406932 6:33850917-33850939 AGTGCCGGTCACCCTGGGTCTGG - Intergenic
1016388170 6:143549056-143549078 GCACCATGTCAATCTGGGTCGGG - Intronic
1017514832 6:155146844-155146866 CGAGCAGGTCACTTGAGGTCAGG - Intronic
1018423695 6:163661925-163661947 GGAGCAGGTCAGTGCGGGTCAGG + Intergenic
1018450109 6:163899909-163899931 CGAACAGGTCACTTGGGGTCAGG + Intergenic
1018734263 6:166675521-166675543 GGAGCACGTCGCGCTGGGGCTGG - Intronic
1021270443 7:18578083-18578105 GGAGCAGAGCACTCTGGGAAAGG - Intronic
1021654374 7:22860645-22860667 GGACCAGATCACTGTGGGCCTGG + Intergenic
1023870867 7:44262389-44262411 GGAGCAGCTGACTCTGGGCCAGG + Intronic
1025058599 7:55785263-55785285 GGGGCAGATCACTCGAGGTCAGG - Intergenic
1025171233 7:56758937-56758959 GGAGCAGATCATTCAAGGTCAGG + Intergenic
1025702772 7:63835175-63835197 CGGGCAGGTCACTCTAGGCCAGG + Intergenic
1025915314 7:65860978-65861000 GGGGCAGATCACTCAAGGTCAGG + Intergenic
1026869326 7:73841108-73841130 GGATCAGGGCACTGTGGGGCGGG + Exonic
1027164944 7:75827737-75827759 CCAGCAGGTCACCCTGGCTCTGG - Intergenic
1030208302 7:106972214-106972236 GGAGCAGATCACTTGAGGTCAGG + Intergenic
1031139882 7:117930801-117930823 TGAGCAGATCACTTTAGGTCAGG - Intergenic
1033585250 7:142770105-142770127 GGGGCATGTCATTCTGGTTCAGG + Intergenic
1035928947 8:3760173-3760195 GGAGCATCTCAATCTAGGTCAGG + Intronic
1036855467 8:12287109-12287131 AGAGCTGGTCTCTCTTGGTCCGG + Intergenic
1038863832 8:31416620-31416642 TGAGCAGGTCCCTATGGGACAGG - Intergenic
1039867952 8:41522072-41522094 GGAGCAGATCACTTGGTGTCAGG + Intergenic
1039996994 8:42542112-42542134 GGAGCAGGTCTCGCAGGATCGGG + Intronic
1041516324 8:58702580-58702602 GGAGCAGATCACTTGAGGTCAGG - Intergenic
1042642394 8:70950899-70950921 TGAGCAGATCACTCGAGGTCAGG - Intergenic
1045860687 8:106812200-106812222 GTAGCAGGTTCCTCTGGGACTGG + Intergenic
1045980887 8:108185850-108185872 TGAGCAGGTCACTTAAGGTCAGG + Intergenic
1046767311 8:118083798-118083820 CGAGCAGATCACTTGGGGTCAGG + Intronic
1047373783 8:124277284-124277306 GGAGCAGGCCACACTGAGACAGG - Intergenic
1048115134 8:131512603-131512625 GGAGCAGGACAGTCTTGGACCGG - Intergenic
1049773365 8:144393849-144393871 GGAGCAGGTGTGTCTGGGTGGGG - Intronic
1049789869 8:144467609-144467631 GGAGCAGCTCATCCTGGGACAGG + Exonic
1050331373 9:4549649-4549671 GGAAGAGGTCACTCCAGGTCAGG - Intronic
1051170001 9:14312894-14312916 GCAGCAGGTCACTATGGACCAGG + Intronic
1052710437 9:32049187-32049209 GAAGCAGTTCACTTTAGGTCAGG - Intergenic
1052827146 9:33185520-33185542 TGGGCAGGTCACTCGAGGTCAGG + Intergenic
1052900951 9:33794676-33794698 GGGGCATGTCATTCTGGTTCAGG + Intronic
1055106339 9:72517048-72517070 GGGGCAGATCACTTGGGGTCAGG - Intergenic
1055389020 9:75798527-75798549 TGAGCAGGTCACACTTGTTCAGG - Intergenic
1059880069 9:118678816-118678838 CGGGCAGGTCACTCGCGGTCAGG + Intergenic
1060545103 9:124454809-124454831 GGAGCCACTGACTCTGGGTCTGG - Intronic
1061178813 9:129012324-129012346 GGAGGGGGTCACCCTGGGCCAGG + Intronic
1061387945 9:130301474-130301496 GTAGCAGGTGGCTCTGGGTTTGG + Intronic
1061655139 9:132083640-132083662 AGAGCAGATCACTCGAGGTCAGG + Intergenic
1062183742 9:135205254-135205276 AGAGCTGGGCACTGTGGGTCTGG - Intergenic
1062282959 9:135760115-135760137 GGGGCAGGTCACCCTGGCACTGG - Intronic
1062529075 9:136992110-136992132 GGAGCAGGGCGTCCTGGGTCAGG - Intergenic
1062580469 9:137227183-137227205 GGAGCTGGTCACCATGCGTCAGG - Intergenic
1062699428 9:137891278-137891300 GGAGCAGCTGCCTCTGGATCTGG + Intronic
1185907209 X:3946526-3946548 GGAGCAGGTCACTCCGTCTAAGG - Intergenic
1189882261 X:45504648-45504670 GGGGCAGATCACTCGAGGTCAGG + Intergenic
1193134825 X:77959013-77959035 GGAGCAGATCACCCGAGGTCAGG - Intronic
1196489859 X:116253053-116253075 GGAGTAGGACCCTCTGAGTCAGG - Intergenic
1197976254 X:132168804-132168826 CGGGCAGGTCACTCGAGGTCAGG - Intergenic
1200217018 X:154372360-154372382 TGAGCAGGCCCCTCTGGGTCTGG - Intronic
1201222904 Y:11789252-11789274 GCTGCAAGTCACTCTGGCTCCGG - Intergenic