ID: 935736262

View in Genome Browser
Species Human (GRCh38)
Location 2:106108863-106108885
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 380
Summary {0: 3, 1: 27, 2: 53, 3: 90, 4: 207}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935736262 Original CRISPR GGAAGTGCACAAATGGGCCT AGG (reversed) Intronic
900805240 1:4763259-4763281 GGAATTGCCCCAAAGGGCCTAGG - Intronic
900812571 1:4818275-4818297 GGAAGTGCACAGATGGGCCAAGG + Intergenic
900842944 1:5070461-5070483 GGAAGTGCACAGATGGGCCTAGG - Intergenic
900883859 1:5401814-5401836 GGAAGTGCACAGATGGGCCTAGG - Intergenic
900913692 1:5619853-5619875 GAAAGTGTACAGAGGGGCCTAGG + Intergenic
901042552 1:6374232-6374254 GGAGGTGGCCAAATGGCCCTGGG + Intronic
901428794 1:9199815-9199837 GGAACTTCACAAATGGGTCCCGG - Intergenic
901746462 1:11376983-11377005 TCAAGTGCACAGATGGACCTGGG - Intergenic
902988519 1:20170533-20170555 GCAAGTAAACCAATGGGCCTGGG + Intronic
903143496 1:21354816-21354838 GGAGTTGCAGAATTGGGCCTAGG - Intergenic
903672841 1:25046663-25046685 GCAGGTGAGCAAATGGGCCTGGG - Intergenic
904588745 1:31595577-31595599 GGAAATGCTCAGATGGGCTTAGG - Intergenic
905640748 1:39588156-39588178 GGAAGTGCACGGATTGGCCTAGG - Intergenic
908395856 1:63725161-63725183 GGAAGTGTACAGATGGGCCTAGG - Intergenic
909611026 1:77552001-77552023 GGAAGTGCACAGATGGGCCTAGG - Intronic
910210193 1:84784310-84784332 GTAAGTGTACAAATAGGACTGGG - Intergenic
911416440 1:97581006-97581028 GGAAGTACACAGGTGGGCCTTGG + Intronic
911645753 1:100335711-100335733 GGAAGTGAAGAAATGGGGCAAGG - Intergenic
916217506 1:162410027-162410049 GGAAGTACACAAATGGGCCTTGG - Intronic
916721627 1:167488657-167488679 GAAAGTACACAGATGGGCCTAGG + Intronic
916842706 1:168616095-168616117 GGAAATACACAAATAGGCCTAGG - Intergenic
918983138 1:191589128-191589150 GGTAGTGCACAGATGAGTCTAGG + Intergenic
920055883 1:203191363-203191385 GGAAGTGCACAGATGGGCCTAGG - Intergenic
920291598 1:204927533-204927555 AGAAGTCCAGAAAGGGGCCTTGG - Intronic
920673229 1:208020724-208020746 GGGAGTGCACCCTTGGGCCTGGG - Intergenic
922222543 1:223619353-223619375 GGAGGTGCACAAATGGAACCTGG - Exonic
922232572 1:223699670-223699692 GGAAGTGCACAGATGGGCCTAGG - Intergenic
922340699 1:224652721-224652743 GGAAGTCCAGAAATGAGCCCTGG - Intronic
922369594 1:224896057-224896079 GTAAGTGCACAGATAGGCTTAGG + Intergenic
922599536 1:226839041-226839063 GAAGGTGCACAGATGGGCCTAGG + Intergenic
922767553 1:228163743-228163765 GCAAGTGCACAGATGGGCCTAGG - Intergenic
922818214 1:228466306-228466328 GAAAGTGCACAGATGGACCCAGG - Intergenic
924324921 1:242886018-242886040 GGAAGTGGACACATAGGCTTAGG + Intergenic
924505876 1:244683253-244683275 GTACGTGTACACATGGGCCTAGG + Intronic
924809892 1:247391736-247391758 GGAAATGCACAGATGGGTCTAGG - Intergenic
1063974219 10:11402345-11402367 GGAGGTGTACAGATGAGCCTCGG - Intergenic
1065928204 10:30455139-30455161 TGAAGTGCAAAACTGTGCCTTGG + Intronic
1066443595 10:35461559-35461581 GGAAGTGCACAGTTGGGCCCAGG + Intronic
1066515029 10:36149079-36149101 AAAAGTGCACATATGGCCCTGGG - Intergenic
1067250021 10:44578279-44578301 GGAAATGCACAGATGGGTCCAGG + Intergenic
1067969584 10:50954361-50954383 TGAAGTGCAGCAATGGGCCCAGG - Intergenic
1068070655 10:52190669-52190691 AAAAGTGCACAAATGGGCTTTGG - Intronic
1068139984 10:52993747-52993769 TGAAGAGCACAGATGGACCTAGG - Intergenic
1068243847 10:54339661-54339683 GGAAGTATACAGATGAGCCTAGG - Intronic
1069473741 10:68715236-68715258 TTAAGTGCACAGGTGGGCCTAGG + Intergenic
1069797733 10:71063929-71063951 GGAATGGCACAAGAGGGCCTGGG - Intergenic
1069825797 10:71254349-71254371 GGAGGAGCACAAATGGCTCTGGG + Intronic
1070548539 10:77472969-77472991 GGAAGTGCACATTTGGGTTTTGG - Intronic
1071223111 10:83492987-83493009 GAAAGTGCACAGATGGGCCTAGG + Intergenic
1071425019 10:85540617-85540639 GGAAGTGCATAGATGGGCCTGGG + Intergenic
1071586744 10:86830318-86830340 GGAAGTACACAGATAGGCCTGGG + Intronic
1073987171 10:109222922-109222944 CGAAGGGCATAAATGGGCTTTGG - Intergenic
1074848058 10:117416252-117416274 GGAAGCACACAGATGGGCCTAGG + Intergenic
1075121668 10:119669147-119669169 GGAAGTGCACAGATGGGCCTAGG + Intronic
1075624768 10:123954298-123954320 GGAAGTGCACAGACGGGCCGAGG + Intergenic
1075665040 10:124223935-124223957 GGAAGTGCACAGGAAGGCCTGGG - Intergenic
1078598019 11:12705386-12705408 TGCAGTGCAGAAAGGGGCCTGGG + Intronic
1079127731 11:17730878-17730900 GGAAGTCCAGAAAGGGGCCAAGG - Intergenic
1084195367 11:67521523-67521545 GGAAAGGGACAAATGGGCCGGGG - Intronic
1086961762 11:92985252-92985274 AGAAGTGGACAAAGGGGACTGGG - Intergenic
1087357890 11:97117930-97117952 GGAAGTACACAGATGGTCCTAGG + Intergenic
1087603877 11:100350526-100350548 AGAAGTACACAAAAGGGCCATGG - Intronic
1087899600 11:103625928-103625950 GGAAGTGCACAGATGGGCAAAGG + Intergenic
1088066208 11:105723039-105723061 GGAAGAACACAACTGGACCTTGG + Intronic
1089162284 11:116447842-116447864 GGAAGGGCACACAAGGTCCTAGG + Intergenic
1090286760 11:125506346-125506368 GGAAGTGCACAGATTGATCTAGG - Intergenic
1091279876 11:134375762-134375784 GGATGTGCAGACATGGGCCATGG - Exonic
1091279890 11:134375832-134375854 GGATGTGCAGACATGGGCCATGG - Exonic
1091279904 11:134375902-134375924 GGATGTGCAGACATGGGCCATGG - Exonic
1091279918 11:134375972-134375994 GGATGTGCAGACATGGGCCATGG - Exonic
1091279932 11:134376042-134376064 GGATGTGCAGACATGGGCCATGG - Exonic
1091279946 11:134376112-134376134 GGATGTGCAGACATGGGCCATGG - Exonic
1094122172 12:26986161-26986183 AGATGTGCGCAGATGGGCCTAGG - Intronic
1094177184 12:27553040-27553062 GGAAGTGCACGCAGAGGCCTAGG + Intronic
1094364490 12:29665690-29665712 GAAAGTACACAGATGGGCCTAGG - Intronic
1094474088 12:30827967-30827989 GGATGTGCCCAGATGGGCCTTGG - Intergenic
1095752405 12:45727698-45727720 GGAAGTGGAGATGTGGGCCTCGG - Intergenic
1097387089 12:58962937-58962959 GGAGGTGCACAGATGGGCCTAGG - Intergenic
1098878392 12:75891188-75891210 GAAAGTACACAGATGAGCCTAGG - Intergenic
1099926752 12:89027917-89027939 GGAAGTGCACAGATGGGCCTAGG - Intergenic
1100009591 12:89937532-89937554 GGAAGTGGACAAGAGGGACTTGG + Intergenic
1100751366 12:97701934-97701956 GGAAATGCACAGATGGGCCTAGG - Intergenic
1100763757 12:97839437-97839459 GGAAGTACACAGATGGGCCCAGG + Intergenic
1100950377 12:99842427-99842449 GGAAGTACACAGATGGGCCTAGG - Intronic
1101153840 12:101908779-101908801 GGAAGTGCACAGATGGACCTAGG + Intronic
1101880136 12:108620797-108620819 GGAAGTGCACAGATGGGCCTAGG - Intergenic
1102463848 12:113116404-113116426 GGAAGAGCACAAGTGCGCATGGG + Intronic
1102637480 12:114336756-114336778 GGAAGTACACAGATTGGCCCAGG - Intergenic
1106332668 13:28753966-28753988 GGAAGTGCATAGAAGGCCCTAGG - Intergenic
1106825786 13:33518994-33519016 TAAAGTGCTCAGATGGGCCTAGG - Intergenic
1106948295 13:34853528-34853550 GGAAGTGCACAGAAAGGCCTAGG + Intergenic
1107502341 13:40993374-40993396 GGCAGTGCACCGATGGGTCTGGG + Intronic
1107963355 13:45578044-45578066 GGAAGTGCACAGATGGACCTAGG - Intronic
1107966194 13:45600313-45600335 GGAAGTGCACAGATGAATCTGGG - Intronic
1108481243 13:50874146-50874168 GGAAGTGCCCAGATGGGGCTAGG + Intergenic
1109627595 13:64995733-64995755 GGAAGTGCAAAGATGGGCCTAGG + Intergenic
1110893271 13:80716457-80716479 GGAAGTACAGAGATGGGCCTAGG + Intergenic
1112278710 13:98044314-98044336 GCAAGTGCAGAGATGGGCCTAGG + Intergenic
1112880968 13:104106111-104106133 GGAAGTCAACCAAGGGGCCTAGG + Intergenic
1114156865 14:20113928-20113950 GGATATTCACAAATGGGCTTAGG - Intergenic
1114535329 14:23418869-23418891 GGGACTGCACAAATGGGTCCTGG - Intronic
1116189794 14:41649537-41649559 TGAAGTGCACAGATGGGCCTAGG - Intronic
1116381776 14:44277625-44277647 GAAAGTCCATAAATGGGCCCAGG - Intergenic
1116616129 14:47142100-47142122 GGAAATGAACACAGGGGCCTTGG - Intronic
1117626727 14:57647692-57647714 GGAAGAACACAGATGGGTCTAGG - Intronic
1118477598 14:66132978-66133000 GGAAGTGAAGATATGTGCCTTGG - Intergenic
1118511866 14:66483919-66483941 GCAAGTTAACAAATGGGCATTGG + Intergenic
1118523236 14:66611019-66611041 GAAAGTGCACAGATGGGCCTAGG + Intronic
1118908058 14:70037319-70037341 GGCAGTAGCCAAATGGGCCTTGG - Intergenic
1119928934 14:78525519-78525541 GGCAGTGCACAGATAGGGCTGGG - Intronic
1119962078 14:78870178-78870200 GGAAGTGCACAGATGAGCCTAGG + Intronic
1120280217 14:82429741-82429763 GGGAGTTCACAGATGGGCCAAGG + Intergenic
1121247643 14:92473874-92473896 GCAGGAGCACAAATGTGCCTGGG + Intronic
1122717185 14:103702769-103702791 GGACGTGCACAGATGGGCCTAGG - Intronic
1124828292 15:33122085-33122107 GGAAGTGCAGGAAAGGGCCTGGG + Intronic
1126901727 15:53321477-53321499 GGAAATGCACAGATGGGCCCAGG - Intergenic
1128211942 15:65909203-65909225 GGAAGTACACAAGTGGGCCAGGG + Intronic
1128820703 15:70650187-70650209 GGAAGTGCACAGATGGGCCTAGG + Intergenic
1129141941 15:73606845-73606867 GGAAGTTCACAGATGGGCCTAGG - Intronic
1130350137 15:83084276-83084298 TGAAGGGAACAAATGGTCCTGGG - Intergenic
1131583662 15:93670900-93670922 GGAAGTGTATGAATGGGCTTTGG + Intergenic
1132142209 15:99405426-99405448 GGAAATGCAAAGATGAGCCTAGG + Intergenic
1132644085 16:990836-990858 GGCAGTGCCCAGATGGGCCCAGG + Intergenic
1135054713 16:19221279-19221301 GGTGGTGCACTGATGGGCCTAGG + Intronic
1135586133 16:23672530-23672552 GCAAGTGAACAAATGAGTCTGGG + Exonic
1138186062 16:54978545-54978567 GCAAGCCCCCAAATGGGCCTTGG + Intergenic
1138761597 16:59550425-59550447 GGAAATGCACAGATGAGCCTAGG + Intergenic
1139515202 16:67448749-67448771 GGAAGGACCCAACTGGGCCTTGG - Intronic
1141644625 16:85360594-85360616 GGCAGTGCACAGCTGGGCCCGGG - Intergenic
1141846188 16:86610722-86610744 GGAAGTGCCCATATGGGAGTGGG + Intergenic
1143508370 17:7381913-7381935 GGAAGGACACAGATGAGCCTGGG + Intronic
1144220761 17:13097770-13097792 GAAAGCGCATAGATGGGCCTAGG + Intergenic
1144344818 17:14340176-14340198 GGAAGTGCACAGGAGGTCCTGGG - Intronic
1144588201 17:16501747-16501769 GGAAGTGCACAGATGGGCCTAGG - Intergenic
1148087411 17:45002626-45002648 AGAAGTGCACAAATAGTGCTCGG + Intergenic
1149254883 17:54814677-54814699 GGAAGTACACAAATGGGCAGAGG + Intergenic
1149937721 17:60825712-60825734 GGAAGGGCAAAAAAGGGCCTAGG + Intronic
1151801831 17:76383619-76383641 GGCAGGTCACCAATGGGCCTTGG + Intronic
1152408737 17:80111585-80111607 GGAAGTACAAGGATGGGCCTGGG + Intergenic
1152655513 17:81517611-81517633 GGAGGGTCACAAACGGGCCTGGG - Intronic
1153095329 18:1394784-1394806 GGAAGAGCACGGATGGGACTAGG + Intergenic
1153354584 18:4121383-4121405 GGAAGTGCCTGGATGGGCCTAGG - Intronic
1153943977 18:10002804-10002826 GGAAGTGCATGCATGGGCCAAGG - Intergenic
1153944233 18:10004630-10004652 GGAAATGCACATATGGGTCTAGG - Intergenic
1156014207 18:32528918-32528940 GGTAATGCACAAGTGGGCTTGGG - Intergenic
1158094853 18:53758746-53758768 GGAAGTGCAGAAATGGGCCTAGG + Intergenic
1159140916 18:64393173-64393195 GGAAGTTCACAGATGTGCCTAGG - Intergenic
1159507452 18:69355785-69355807 GGAAATGCACAGATGGGCCTAGG - Intergenic
1159821731 18:73154416-73154438 GGAAGGGCAGAGAAGGGCCTGGG - Intronic
1162621752 19:11849143-11849165 GGAGCTGCACAAAAGGGCTTCGG - Intronic
1163358709 19:16831457-16831479 GGAAGTGGGCAAAAGGGTCTTGG - Intronic
1163407302 19:17130881-17130903 AGAAGTGCACAGATGGGACTGGG - Intronic
1165682763 19:37791545-37791567 TGAAGTGTACAGATGGGCCCAGG + Intronic
1165722152 19:38087097-38087119 GGAGGTGCACAGATGGGCCTAGG + Intronic
929692225 2:44084560-44084582 GGAAGTATACAGATGGGCCTAGG - Intergenic
929816427 2:45236559-45236581 GAAAGTGTACTAAGGGGCCTGGG + Intergenic
930273824 2:49288241-49288263 GGAAGTGCACAGATGGGCTTGGG + Intergenic
931804042 2:65787743-65787765 GGAAGTGTACAGATGGACTTAGG - Intergenic
932601429 2:73129213-73129235 GGAAGTGCACAGGTGGGCCTAGG - Intronic
932986792 2:76736133-76736155 GGAAGTATACATATGGGCCTAGG - Intergenic
933293241 2:80461132-80461154 GGAAATGCACAAATGGGAGTAGG - Intronic
933373907 2:81454021-81454043 GAAAGTGCACAAATGTCCTTTGG + Intergenic
933435123 2:82239688-82239710 GGAAATGCACACATGGACTTTGG - Intergenic
935390168 2:102542664-102542686 GGAAGTACACAAACGGGCCTTGG + Intergenic
935594693 2:104869546-104869568 GGAACTGCACAAGTAGGACTGGG - Intergenic
935736262 2:106108863-106108885 GGAAGTGCACAAATGGGCCTAGG - Intronic
935828677 2:106976766-106976788 GGAAGTGCAGAACAAGGCCTTGG + Intergenic
936289416 2:111208720-111208742 GGCAGTACACCAATAGGCCTGGG - Intergenic
936476815 2:112846728-112846750 GAAAGTGTACAAATGTGCCTGGG - Intergenic
937152428 2:119695204-119695226 GAATGTGGACAAATGGGACTGGG + Intergenic
937454070 2:122026189-122026211 GGAGGTGCACATACGGACCTAGG + Intergenic
937816894 2:126260564-126260586 GGAAGTGGACAGATAGGCATAGG + Intergenic
937840945 2:126524054-126524076 GGAAGCACACAAATGAACCTAGG + Intergenic
938182874 2:129199543-129199565 GGAAGTACACAGATGGGCCTAGG - Intergenic
938337485 2:130512355-130512377 GGACGTGCACAGATGGACGTAGG - Intergenic
938352353 2:130608380-130608402 GGACGTGCACAGATGGACGTAGG + Intergenic
939254301 2:139722560-139722582 GTAAATGCACAGATGGGCTTAGG - Intergenic
944539685 2:200743588-200743610 GGAAATGCACAAAGGGGCACAGG + Intergenic
945067828 2:205961957-205961979 GAAAGTGCACAGACGGGCCTAGG - Intergenic
945356104 2:208841438-208841460 GGAAATGCACAGTTGGGCTTAGG + Intronic
946098774 2:217300931-217300953 GGAAGTACACAAATGTGTTTTGG + Intronic
946402033 2:219473223-219473245 GGAAGTGTACAGATGGGCCAAGG - Intronic
946494739 2:220184476-220184498 GGAAGTACACAGATGGGCCTGGG - Intergenic
948433455 2:237935751-237935773 GGAAGTGCACAGAGGGGCCCAGG - Intergenic
948605827 2:239134224-239134246 AGGTGAGCACAAATGGGCCTGGG - Exonic
948751840 2:240137609-240137631 TGCAGTGCACAGATGGGCCTGGG - Intergenic
1170123408 20:12935876-12935898 GGAACTTCACAAATGGGGGTGGG - Intergenic
1171081696 20:22193066-22193088 GTAAGTGTACCAATGGGTCTTGG - Intergenic
1173447626 20:43134298-43134320 GGAAGTACACAGATGGGCCAAGG - Intronic
1176179848 20:63744633-63744655 GGACGTGCTCACCTGGGCCTCGG + Exonic
1177760226 21:25394924-25394946 GAAAGTGCACAGATAGGCCTCGG - Intergenic
1178664187 21:34532289-34532311 GGAAGTGCACAGGTGAGCCTAGG + Intronic
1180800435 22:18629354-18629376 GGAAGTGCTCAGATGTGCCTAGG + Intergenic
1180848693 22:18999185-18999207 GGAGGTTCACAAAGGGACCTGGG + Intergenic
1180851670 22:19024910-19024932 GGAAGTGCTCAGATGTGCCTAGG + Intergenic
1181221284 22:21365908-21365930 GGAAGTGCTCAGATGTGCCTAGG - Intergenic
1183062837 22:35346345-35346367 TGAAGTGCCCATGTGGGCCTTGG - Intronic
1184285078 22:43465903-43465925 AGATGTGCACAAAAGGGCCCTGG - Intronic
1184612275 22:45612359-45612381 GAAACTGCAGAAATCGGCCTAGG - Intergenic
1184881549 22:47307602-47307624 GGAAGTGGGAAAATGGGCATTGG - Intergenic
1184910309 22:47527692-47527714 GAAAGCACACAGATGGGCCTAGG + Intergenic
1184910833 22:47532885-47532907 GGAAGTGCACAGATGGGGCTAGG + Intergenic
1184965142 22:47966038-47966060 GGAAGTGCACAGGTGGGTCTGGG - Intergenic
1185405098 22:50643183-50643205 GGAAGTGCACAGATGGGCTCCGG - Intergenic
949915873 3:8964078-8964100 GGAAGTACACAGATTGGCCTAGG - Intergenic
950487067 3:13280170-13280192 GGAAGTGCAGGGCTGGGCCTAGG + Intergenic
950924799 3:16729697-16729719 GGAAGTGCACAGATGGGCCCTGG + Intergenic
951171994 3:19553553-19553575 AGAATTGAACAAATGGGCCTTGG - Intergenic
951591242 3:24267503-24267525 GGAAGTGCATAGATGAGCCCAGG - Intronic
955848905 3:63197839-63197861 AGAAGTGCTCATTTGGGCCTGGG + Intergenic
956680232 3:71772340-71772362 GGCAGGGCACAAATGGGGCTTGG + Exonic
956706933 3:72007221-72007243 GGAAGTACACAGATGGGGCCAGG - Intergenic
957415688 3:79900437-79900459 GGAAGTGCATAGAAGTGCCTAGG + Intergenic
957782252 3:84834626-84834648 GGAAGTGCAAAGGTGGACCTAGG + Intergenic
958082661 3:88766846-88766868 GGAAGTGAACAAAAGGAACTAGG + Intergenic
958445857 3:94214070-94214092 GGAAGTACAAAGATGGGCCTAGG + Intergenic
959052904 3:101541361-101541383 AGAAGTGCACAGATGGGCTCAGG + Intergenic
959154331 3:102648388-102648410 GGAAATGCACAGGTGGGCTTAGG - Intergenic
959980902 3:112516552-112516574 GGAGGTGCACAGATGGGCCTAGG - Intergenic
960154884 3:114289933-114289955 GGAAGTGCATGGATGGGCCTAGG - Intronic
961350217 3:126295701-126295723 GGAAGTGCACAGATGGGTCAAGG - Intergenic
961386997 3:126528450-126528472 GGTAGTGCACTGGTGGGCCTTGG + Intronic
962924211 3:139976791-139976813 AGAAGTGCACAAATAACCCTAGG - Intronic
963774410 3:149423403-149423425 GGAAATACACAGATGGGCCTAGG + Intergenic
964979548 3:162662566-162662588 TGAAGTGCACAGATGTGCTTAGG + Intergenic
965463115 3:168993450-168993472 GGAAGTGCACAGATGGGCCTAGG - Intergenic
965681853 3:171259975-171259997 GGAAGTGCATAGATGGGCCTAGG - Intronic
965738489 3:171847908-171847930 GAAAGTACACAGATGGGCCTAGG + Intronic
966214652 3:177490124-177490146 GGAAGGACAGACATGGGCCTGGG - Intergenic
966225620 3:177594341-177594363 GGAAATGCACAGATAGGCCTAGG + Intergenic
966238480 3:177728658-177728680 GGAAGTGCACAGACAGGCCTAGG + Intergenic
969527978 4:7713740-7713762 GGAAGTGCTCAGATGGGCCTAGG + Intronic
969850072 4:9948970-9948992 GGAAGTACACAGATGGGCCTAGG - Intronic
970471258 4:16381471-16381493 GGAGGTACACAGATGGGCCTAGG + Intergenic
970471931 4:16387590-16387612 GAAAGTGCATAGATGAGCCTAGG - Intergenic
970921945 4:21404948-21404970 GGAAGTGCACAGATAGGCCTAGG - Intronic
971617311 4:28808582-28808604 GCAATTGCACAAATCTGCCTTGG + Intergenic
971755453 4:30702093-30702115 GGAAGTTCACTGATGGTCCTCGG - Intergenic
974250235 4:59375895-59375917 GAACATGCAGAAATGGGCCTTGG - Intergenic
975758784 4:77597718-77597740 GGAAGTGCACAAATGGCTCTTGG + Intronic
976266329 4:83188899-83188921 GGAAGTACAGAGATGGGCCTTGG + Intergenic
976332979 4:83852960-83852982 GAAAGTGCACAGATGGGCCTAGG - Intergenic
977993679 4:103476422-103476444 GGAAGTGCACAGATGAACCTAGG + Intergenic
979129653 4:117026458-117026480 TGAAGTGCACAAATGGGCCCAGG + Intergenic
979525012 4:121707300-121707322 AGAAGTGCACACGTGGGCCTAGG + Intergenic
979689200 4:123542829-123542851 GGAAGTGCACAGATGGGCCTAGG - Intergenic
980197090 4:129603309-129603331 GCAAGTTCACAGATGGTCCTAGG - Intergenic
980459066 4:133081719-133081741 AGAAGTGCACATATGGGCATAGG - Intergenic
980933019 4:139199413-139199435 GGAAGTACACAGATGAGCCTAGG - Intergenic
981539136 4:145830863-145830885 GGAAGACCACACATGGTCCTAGG - Intronic
982022649 4:151219107-151219129 GGAAGTACACAGATGGGACTAGG - Intronic
982738754 4:159035793-159035815 GGAAGAGCAGATGTGGGCCTTGG - Intronic
983082359 4:163402253-163402275 GGAAGTATACAGATGGGCCTAGG + Intergenic
983426401 4:167589205-167589227 GGAAGTGCACATATGGACTTAGG + Intergenic
983772431 4:171568954-171568976 GGCAGCACAGAAATGGGCCTGGG + Intergenic
984719882 4:182959638-182959660 GGAAGTACACAGATGGGCCTAGG + Intergenic
986065018 5:4226914-4226936 GGAAGTCCACGAATGGACCTAGG - Intergenic
986613679 5:9594720-9594742 GGAAGTGCACAGATGGGCCCAGG + Intergenic
986925762 5:12747679-12747701 GGAAATACAGAAATTGGCCTGGG - Intergenic
987027523 5:13942500-13942522 GGAAGTGTACAGATGGGCCTAGG - Intronic
987259786 5:16191804-16191826 GGAAGTGCACAGATGGGCATAGG - Intergenic
987683463 5:21166463-21166485 AAGAGTGCACAAATGGACCTAGG - Intergenic
988034578 5:25809552-25809574 GGAAGTGAACAAAGGTGTCTGGG + Intergenic
988602558 5:32653563-32653585 GGAAGTGTACAGACAGGCCTAGG - Intergenic
990276366 5:54201409-54201431 AGAAGTGCACAGATGGGTTTAGG - Intronic
991257811 5:64634351-64634373 GGAAGTACACAGATGGGCCTAGG + Intergenic
991403896 5:66283007-66283029 TAAACTGCACAAATGGGGCTAGG - Intergenic
993953365 5:94202098-94202120 GGAAGTGCACAGATGGACCTAGG + Intronic
994865798 5:105268103-105268125 GGAAGTGCACAGATGAACGTTGG - Intergenic
995283798 5:110364234-110364256 GCAAGTACACAGATGGGGCTAGG - Intronic
996831602 5:127746673-127746695 GGAAGTGAACCAATTGTCCTCGG - Intergenic
999432968 5:151539969-151539991 GGAGGTGCATATATGGGCATGGG + Intronic
999642127 5:153682426-153682448 AGAATTGCACAGATGGGCCTAGG - Intronic
1001205286 5:169756522-169756544 AGGAGTGAACAAATGAGCCTAGG + Intronic
1001330761 5:170760765-170760787 GAAAATGCACAGATGGACCTAGG - Intergenic
1001424972 5:171617033-171617055 GGAAGTGCACGCATGGGGTTAGG - Intergenic
1002130168 5:177076365-177076387 GGAAGTGCACAGATGGACCTAGG - Intronic
1002272521 5:178082022-178082044 GGAAGCACACAGATGGGTCTAGG - Intergenic
1002834635 6:855755-855777 GAACGTGCAGAAATGTGCCTAGG - Intergenic
1002875308 6:1204633-1204655 GGAAGTGCACGGATGGGCTTAGG + Intergenic
1004226787 6:13792562-13792584 GGAAGGACACAAATTGGCCGTGG - Intronic
1005214960 6:23515145-23515167 GGAAGTGCACAGATGGACCTAGG - Intergenic
1005577635 6:27205077-27205099 GGAAGAACACAGATGGGCCCTGG - Intergenic
1006387646 6:33740287-33740309 GGAAGTGGACAGATGGCCCCAGG + Intronic
1007247434 6:40472591-40472613 GGAAGTGCACAAATCCAGCTCGG - Intronic
1008134385 6:47756988-47757010 GGAAATATACAAATGGGACTTGG + Intergenic
1008157195 6:48031086-48031108 GAAAGTGCACAGATTAGCCTAGG - Intronic
1008248714 6:49210582-49210604 GCAATTGCACAAATGAGCATGGG - Intergenic
1008373101 6:50758894-50758916 GGAAATGCAAAGATGGGCCTAGG + Intronic
1009622895 6:66098277-66098299 GGAAGTGCACAGATGGGACGAGG + Intergenic
1010004816 6:70984102-70984124 GGAAGTGCACAGATGGGCCTAGG + Intergenic
1010427540 6:75743748-75743770 GGAAGGACACAGATGGACCTAGG + Intergenic
1010508829 6:76692154-76692176 GGAAGTGCACAGATGGGCCTAGG + Intergenic
1012128524 6:95461209-95461231 GGAAGTCCATAAATGGGCATAGG + Intergenic
1015978878 6:138818932-138818954 GGAAGTGCACAGGTGGGCCAAGG + Intronic
1015996402 6:138999260-138999282 GGAAGTGCACAGATGGGCCTAGG - Intergenic
1016443541 6:144109343-144109365 GGAAGTGCACAGATGGGCCCAGG + Intergenic
1017094168 6:150789879-150789901 TCAAGTGCACAAAGGGGCCCAGG + Intronic
1017995367 6:159527560-159527582 GCCACTGCACACATGGGCCTGGG + Intergenic
1019734501 7:2644131-2644153 GGAAGTGCAGACGTGGGCATGGG + Intronic
1020591112 7:10138397-10138419 GGAAGGGCATATATGGGCCTAGG - Intergenic
1022159589 7:27695769-27695791 GGAAGAGCATAGATGGGCCTAGG + Intergenic
1022378841 7:29841029-29841051 GGGAGTGCACAGATGGGCCTGGG + Intronic
1024056731 7:45664186-45664208 GGAAGTGCACCGTTGGGCCTAGG + Intronic
1025006915 7:55362696-55362718 GGAAGTGTGCAGATGGGCCTTGG + Intergenic
1025963449 7:66245569-66245591 AGAAGTGCACAGATGGTCCTAGG + Intronic
1026589236 7:71681194-71681216 GGAAATGCAAAACTGGGGCTGGG - Intronic
1027671585 7:81105903-81105925 GAATGTGTACAGATGGGCCTAGG + Intergenic
1028137017 7:87232618-87232640 GGAAGTGCACAGATGAGCCTAGG + Intergenic
1030785057 7:113650030-113650052 GGAAGTGCACAGATGGGCCTAGG - Intergenic
1031323653 7:120364870-120364892 AGAATTGCACAGATGGGCCTAGG + Intronic
1032099965 7:128967151-128967173 TGAATTGCACAAATTGGCATTGG - Intronic
1032292110 7:130597866-130597888 GAAAGTGCAGAAATTGGCTTTGG + Intronic
1033991048 7:147287422-147287444 GGAATTGCACAGATGGGCCTTGG + Intronic
1035241471 7:157533381-157533403 AGAAGGGCACAGATGGGACTAGG - Intergenic
1036151690 8:6305074-6305096 GGAAGTGCACAGATGGGCCTAGG + Intergenic
1036744905 8:11399875-11399897 GAAAGTACACAGATGAGCCTTGG + Intronic
1036949841 8:13130774-13130796 GGAAGTTCAAAAAGGGGACTGGG - Intronic
1037622727 8:20579120-20579142 GGAAGTTCACAGAAGGGCCTAGG + Intergenic
1037623086 8:20584182-20584204 GTAAGTGCACAGAAGGGCTTAGG + Intergenic
1037887224 8:22601492-22601514 GGCCGTGCACAAATGGAACTGGG - Intronic
1039733920 8:40309549-40309571 GGAAGTGCACAGATGGGCCTAGG - Intergenic
1039734246 8:40313877-40313899 GAAAGTGCACAGATGGGCCTAGG - Intergenic
1039849206 8:41347732-41347754 GGAAGTGCACTTATAGGCCTAGG + Intergenic
1041322331 8:56626168-56626190 GGAAGTGCAAAGATGGGCCTAGG - Intergenic
1041511746 8:58660404-58660426 GGAAGTGCACACAAGGACCTGGG + Intergenic
1042206798 8:66337724-66337746 GGAAGTGCACAGTTGGGCCTAGG - Intergenic
1042216462 8:66433194-66433216 GCAAGTGCACAAGTCTGCCTGGG + Intronic
1042341507 8:67684728-67684750 GGAAATGGACAGATGGGCCTAGG - Intronic
1042584307 8:70318329-70318351 GGAAGTACACAGATGAGCCTAGG - Intronic
1042671048 8:71263542-71263564 GGCAGTGCATACATGCGCCTGGG - Intronic
1042944964 8:74145301-74145323 GGCTTTGCAAAAATGGGCCTGGG - Intergenic
1043342277 8:79254674-79254696 AGAAGTGCATAGATGGGCCCAGG + Intergenic
1043514713 8:80985312-80985334 GGAAGTCCAGACATCGGCCTCGG - Exonic
1044510323 8:93069947-93069969 GGAAGTGCACAGATGGGCCTAGG - Intergenic
1044844528 8:96367072-96367094 GCAACTTCATAAATGGGCCTGGG + Intergenic
1044915401 8:97107915-97107937 GCAAGTGTAGAAATGGGCTTTGG + Intronic
1045848660 8:106666853-106666875 GGAAGTGAACAGATTGGCATAGG + Intronic
1047441799 8:124885239-124885261 GGAAGTGCACAGATGGGCCTAGG + Intergenic
1047756469 8:127922763-127922785 GGAAGTAAAGAGATGGGCCTGGG - Intergenic
1047757241 8:127928084-127928106 GGAAGTACACAGATGGGCCTAGG - Intergenic
1048567324 8:135615182-135615204 GGAGCTCCACAGATGGGCCTAGG + Intronic
1049087921 8:140492557-140492579 GGAAGTACCCAGGTGGGCCTTGG - Intergenic
1049505134 8:142992148-142992170 GGAAAGGCACAGATGGGCCTGGG + Intergenic
1051464397 9:17360610-17360632 GGAAGTGCACAGATGGGCTTAGG + Intronic
1051775991 9:20634621-20634643 GGAAGTGCACAAATGGGCCTAGG + Intergenic
1053537185 9:38937619-38937641 GGAAGTGCACAGATGGGCCTTGG + Intergenic
1054628950 9:67426311-67426333 GGAAGTGCACAGATGGGCCTTGG - Intergenic
1055497126 9:76866919-76866941 GAATGTGCACACAGGGGCCTGGG - Intronic
1055760696 9:79604313-79604335 GCAAGTGAATAAATGGGCCCTGG - Intronic
1055804271 9:80075553-80075575 GGAAGTGAACTAATGGGCCTAGG - Intergenic
1057191920 9:93093206-93093228 GGAAGTTCACAGATGGGCCAAGG - Intergenic
1057630334 9:96714913-96714935 GCAAGTGCACAGATGTGCCTAGG + Intergenic
1058581264 9:106460713-106460735 GGAAGTTCTGAAATTGGCCTCGG + Intergenic
1059306912 9:113360907-113360929 TGAAGTGCACAGATGGGCCTGGG - Intronic
1060013534 9:120065880-120065902 GGAAGTACACAGATGTGCCTTGG + Intergenic
1060148956 9:121274898-121274920 GGAAGTGCACAGGTAGGCCTAGG + Intronic
1060552686 9:124492973-124492995 GGAAGTGCACAGCGGGGCCAGGG + Intronic
1061494459 9:130963756-130963778 GGAAGTGCACAGATGGGCCTAGG + Intergenic
1062726291 9:138075928-138075950 GGAAGAGCAGACATTGGCCTGGG - Intronic
1186244333 X:7605100-7605122 GGAGGTACACAGGTGGGCCTAGG - Intergenic
1187753394 X:22492853-22492875 GGAAGTGTTCAAATGGGGATGGG + Intergenic
1187964295 X:24595480-24595502 GGCAGTGCAAAAATAGCCCTGGG + Intronic
1188410592 X:29867443-29867465 GGAATGGCAAAAAAGGGCCTAGG - Intronic
1188539637 X:31235106-31235128 AGAAGTGCACAGGTGGGCCTAGG + Intronic
1188759031 X:34002506-34002528 TGAAATGCACAGATAGGCCTAGG + Intergenic
1188779939 X:34269452-34269474 GGAAGTGCACTAAAGGGACCAGG + Intergenic
1189003165 X:36966785-36966807 GGAAGTTTACAAATCTGCCTTGG - Intergenic
1189553734 X:42119907-42119929 AGAAGTGCACATCTAGGCCTGGG + Intergenic
1190110204 X:47584427-47584449 GGAAGTGCACAGATGGGCCTAGG + Intronic
1190379748 X:49828418-49828440 GGAAATGCACAGATGGGCCTAGG + Intergenic
1192201602 X:69069834-69069856 GGAAGTGAGTAAATGGGCTTTGG - Intergenic
1192614242 X:72601628-72601650 GGAAGTGCACAAATGGGCCTAGG + Intronic
1193552499 X:82914332-82914354 GGAAGTGTACAGATGAGCCTAGG - Intergenic
1196078152 X:111600341-111600363 GAAAGTACACATATGGGCCAAGG - Intergenic
1198505020 X:137292849-137292871 GAAAGTGCACAGATGAGCCAAGG + Intergenic
1201222451 Y:11785009-11785031 GGAAGTGGACACATAGGCTTAGG + Intergenic
1201287535 Y:12391955-12391977 GGAAACGCACAACCGGGCCTGGG + Intergenic
1201463560 Y:14255383-14255405 GGAAGTACACATGTGGGCCTTGG - Intergenic
1201589648 Y:15601036-15601058 GGAAGTGCACAGATGGGCCTGGG - Intergenic