ID: 935738172

View in Genome Browser
Species Human (GRCh38)
Location 2:106123078-106123100
Sequence GTGGACTTCAGGATCTACGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 59}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935738160_935738172 26 Left 935738160 2:106123029-106123051 CCCGAGGTCCTATTGGATTCACG 0: 1
1: 0
2: 0
3: 2
4: 27
Right 935738172 2:106123078-106123100 GTGGACTTCAGGATCTACGATGG 0: 1
1: 0
2: 0
3: 4
4: 59
935738168_935738172 -2 Left 935738168 2:106123057-106123079 CCAGTAATCCTCACTTTGAGGGT 0: 1
1: 0
2: 2
3: 14
4: 214
Right 935738172 2:106123078-106123100 GTGGACTTCAGGATCTACGATGG 0: 1
1: 0
2: 0
3: 4
4: 59
935738166_935738172 -1 Left 935738166 2:106123056-106123078 CCCAGTAATCCTCACTTTGAGGG 0: 1
1: 0
2: 2
3: 10
4: 78
Right 935738172 2:106123078-106123100 GTGGACTTCAGGATCTACGATGG 0: 1
1: 0
2: 0
3: 4
4: 59
935738164_935738172 0 Left 935738164 2:106123055-106123077 CCCCAGTAATCCTCACTTTGAGG 0: 1
1: 0
2: 0
3: 13
4: 135
Right 935738172 2:106123078-106123100 GTGGACTTCAGGATCTACGATGG 0: 1
1: 0
2: 0
3: 4
4: 59
935738170_935738172 -10 Left 935738170 2:106123065-106123087 CCTCACTTTGAGGGTGGACTTCA 0: 1
1: 0
2: 1
3: 13
4: 161
Right 935738172 2:106123078-106123100 GTGGACTTCAGGATCTACGATGG 0: 1
1: 0
2: 0
3: 4
4: 59
935738163_935738172 18 Left 935738163 2:106123037-106123059 CCTATTGGATTCACGTGGCCCCA 0: 1
1: 0
2: 0
3: 4
4: 53
Right 935738172 2:106123078-106123100 GTGGACTTCAGGATCTACGATGG 0: 1
1: 0
2: 0
3: 4
4: 59
935738161_935738172 25 Left 935738161 2:106123030-106123052 CCGAGGTCCTATTGGATTCACGT 0: 1
1: 0
2: 0
3: 2
4: 56
Right 935738172 2:106123078-106123100 GTGGACTTCAGGATCTACGATGG 0: 1
1: 0
2: 0
3: 4
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935738172 Original CRISPR GTGGACTTCAGGATCTACGA TGG Exonic
905366982 1:37457768-37457790 TGGGACTTGGGGATCTACGAGGG - Intergenic
907974512 1:59418443-59418465 GAGGACTTCAGGATTTAAAAGGG + Intronic
920338859 1:205262803-205262825 GGGGACTGCAGGATCTAAGGAGG + Intronic
923738523 1:236634723-236634745 GTGGACTTCAGTATCCATGTGGG - Intergenic
1070738974 10:78889603-78889625 GTGGTCTTCAGGATCTCCAAAGG - Intergenic
1075172864 10:120132044-120132066 GCTGATTTCAGGAACTACGAGGG - Intergenic
1087157954 11:94922978-94923000 GTGGAATACAAGATCTAGGAAGG + Intergenic
1092177019 12:6416855-6416877 GTGGACTATAGGATGTAAGATGG - Intergenic
1098892712 12:76025890-76025912 GTGGAGTACAGGATCTAAAAGGG - Exonic
1101665421 12:106808297-106808319 GTGGATTTCAGTATCTATGGAGG + Intronic
1103390173 12:120566816-120566838 GTGGACTTCTGGGTCTGCAAAGG - Exonic
1103584594 12:121942623-121942645 CTGGACTTCAGCATCTGAGATGG - Exonic
1104148087 12:126054881-126054903 GTGCACTTAAGGTTGTACGAAGG + Intergenic
1107705256 13:43096848-43096870 GTGGACTCAAGGATCTAAGAAGG - Intronic
1117224316 14:53639044-53639066 TTGGACTTCTGGATCTACTAAGG - Intergenic
1117830450 14:59744724-59744746 GTGGACTTCTGGATCTTTTAGGG - Intronic
1121085098 14:91139874-91139896 GAGGACTTCAGGATTTAAAAGGG + Intronic
1121878544 14:97477912-97477934 CTGGACTGCAGGTTCTATGAAGG - Intergenic
1127563344 15:60162465-60162487 GGGGACTTCAGGATCTGTAAGGG + Intergenic
1141309727 16:82901808-82901830 CTGGACTTCAGGCTCCATGAGGG - Intronic
1143776472 17:9202560-9202582 GGGGACTTCAGTATCTACCATGG + Intronic
1147578866 17:41617584-41617606 GTGGACCCCAGGATCTACAGAGG + Intergenic
1149951545 17:60993153-60993175 GTGGAATACAAGATCTATGAGGG - Intronic
1157973757 18:52301538-52301560 CAGGACTTCAGGAGCTAGGAAGG + Intergenic
1163632777 19:18425651-18425673 GTGGAGGTCAGGATCTAGCAGGG + Intronic
1164589631 19:29499596-29499618 CTGGACTTCAGGAGCTGCCATGG - Intergenic
1164887517 19:31794912-31794934 TAGGACTTCTGGATCTACTAAGG - Intergenic
935738172 2:106123078-106123100 GTGGACTTCAGGATCTACGATGG + Exonic
938552836 2:132396433-132396455 GTGGAGTCCAGGAACTAGGAAGG + Intergenic
939377037 2:141381948-141381970 GTGGAGCCCAGGATCTAGGAAGG + Intronic
1177139136 21:17340040-17340062 GTGGATTTCTGGTTGTACGAAGG - Intergenic
949372133 3:3347126-3347148 TTGGACTTCAGAATCTGTGATGG + Intergenic
954091587 3:48288795-48288817 TTGGACTGCAGGATGTAGGAAGG + Intronic
957899227 3:86466768-86466790 TTGGAATTTAGGATCTACCAGGG + Intergenic
958589871 3:96142568-96142590 ATGGACTTCAGGTTCCACAATGG + Intergenic
961339928 3:126211350-126211372 GTGAACTTCATGATCCATGATGG - Intergenic
965177562 3:165355408-165355430 GTGAGTTTCAGGATCTACAAAGG - Intergenic
968455608 4:697638-697660 GTGGACTTCAGGATGGACTTCGG - Intergenic
969314794 4:6375350-6375372 GAGGCCTTCAGCATCTACAAAGG - Intronic
970124869 4:12797799-12797821 GTGGACTTCAGGGTCTAATGGGG + Intergenic
973330844 4:48908912-48908934 GTGGTCTGGAGGATCTACTAGGG - Intergenic
976188209 4:82464132-82464154 GTTGACATCAGGATCTACATTGG - Intergenic
978540361 4:109810132-109810154 GTGGTATTCAAGATCTAAGAAGG - Intergenic
985636038 5:1036380-1036402 GTGGCCTCCAGGACCTACCAGGG - Exonic
986149948 5:5119524-5119546 GTGGAATTCAGAATCTAAGTGGG - Intergenic
992293497 5:75304597-75304619 GTGGAAGTCAGGGTCTGCGATGG - Intergenic
995736331 5:115303987-115304009 GAGTACTTCAGGATCAAGGAAGG - Intergenic
997579979 5:135011073-135011095 GTGGGCATCAGGAGCTACGGTGG + Intronic
998116720 5:139543449-139543471 GTGCAATCCAGGATCTACGTGGG - Intronic
1003779904 6:9412986-9413008 GTGGCCCTCAGAATTTACGAGGG + Intergenic
1013420972 6:109966553-109966575 TTCCACTTCAGGATCTAAGATGG + Intergenic
1022842654 7:34179565-34179587 GTAGACTTCAGGGTCAAAGAAGG - Intergenic
1030350827 7:108484356-108484378 GTGGTCTACAGGAACTACCATGG - Intronic
1034712523 7:153206414-153206436 CTGGACTTAAGGATTTAAGAGGG - Intergenic
1037066066 8:14578940-14578962 GTTTACTTTAGGATCTAGGAAGG + Intronic
1038654968 8:29441852-29441874 GTGGAAGTCAGCATCTAAGATGG - Intergenic
1042500328 8:69501865-69501887 GTGGCCGTCAGCACCTACGATGG - Exonic
1042836360 8:73082088-73082110 GTGGACTTCACAATCAAGGAAGG - Intronic
1049538814 8:143196359-143196381 GTGCACTTCCGGTTGTACGATGG + Intergenic
1051821845 9:21179239-21179261 TTGGACTTCAGGTTCTCTGAAGG + Intergenic
1060410123 9:123394730-123394752 GTGGGCTTCAGGCTCTGCGGTGG + Intronic
1061867349 9:133499624-133499646 GGGGACATCAGGAGCTAAGAAGG + Intergenic
1189012801 X:37063338-37063360 ATGTACTTCAGGATCTACTGGGG - Intergenic
1198924692 X:141776023-141776045 GTGAAATTCAGGATCTGGGATGG - Intergenic