ID: 935744087

View in Genome Browser
Species Human (GRCh38)
Location 2:106175834-106175856
Sequence TGTATTTATACCCATGGGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 150}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935744087_935744091 13 Left 935744087 2:106175834-106175856 CCAAGCCCATGGGTATAAATACA 0: 1
1: 0
2: 1
3: 11
4: 150
Right 935744091 2:106175870-106175892 TCTGCCACTATGTTTTAAAGTGG 0: 1
1: 0
2: 1
3: 19
4: 209
935744087_935744093 17 Left 935744087 2:106175834-106175856 CCAAGCCCATGGGTATAAATACA 0: 1
1: 0
2: 1
3: 11
4: 150
Right 935744093 2:106175874-106175896 CCACTATGTTTTAAAGTGGTTGG 0: 1
1: 0
2: 3
3: 13
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935744087 Original CRISPR TGTATTTATACCCATGGGCT TGG (reversed) Intronic
901774555 1:11551207-11551229 TGTTCTTCTACCCATGTGCTGGG - Intergenic
901939681 1:12652432-12652454 TGTCTTGATACCGGTGGGCTGGG + Intronic
906936458 1:50218163-50218185 TGTACTTATAGTCATGGGATTGG - Intergenic
907717989 1:56945585-56945607 GGTATTTAGAACCATGGGATTGG + Intronic
908333041 1:63090177-63090199 TTTATTGATACACATGGTCTTGG - Intergenic
912528854 1:110305612-110305634 TGTAGTTCTACCCTTGGGCTTGG - Intergenic
915514157 1:156402941-156402963 GGAATTTATACACATGTGCTTGG + Intergenic
916244945 1:162677900-162677922 ATTATTTATACCTATGTGCTGGG + Intronic
918108916 1:181438637-181438659 TTTATTTATACCCATGAGAATGG + Intronic
918758513 1:188370011-188370033 TGTATTTATAGCAATGGCATTGG + Intergenic
923455234 1:234159794-234159816 TGTATTTACCCTCATGGTCTAGG + Intronic
923617125 1:235547210-235547232 TGTATTAATACCTACGGGCTGGG + Intergenic
1063011326 10:2024292-2024314 AGTATTTGAACCCATAGGCTGGG - Intergenic
1064466797 10:15591511-15591533 TGAACTTAAACCCATTGGCTGGG - Intronic
1064862146 10:19838419-19838441 TGTATTTATTATCATGGGCTAGG - Intronic
1067089661 10:43260165-43260187 TGCATTTATACCCAGATGCTGGG - Intronic
1069024665 10:63525933-63525955 TGTATTTAATCCCATGGGGTAGG - Intronic
1069909339 10:71750121-71750143 TGTTTTTATACACATAGGCAAGG - Exonic
1071710261 10:88042777-88042799 TGCATCTGTACCCAAGGGCTAGG - Intergenic
1072077514 10:91992158-91992180 TGTAATTATACCTCTGTGCTTGG - Exonic
1072637963 10:97189404-97189426 TGTCTATATATGCATGGGCTTGG + Intronic
1072827511 10:98622486-98622508 TGTCTATGTACCCATGGGTTTGG - Intronic
1072964386 10:99958615-99958637 TGTATCTACTACCATGGGCTTGG + Intronic
1074460680 10:113634358-113634380 TGTTTTTCTATCTATGGGCTTGG - Intronic
1075628972 10:123988294-123988316 GGTATTTATACCTCTGAGCTTGG + Intergenic
1077661421 11:4071898-4071920 TGGATTTATTTCCATGGGCTGGG + Intronic
1080792595 11:35535216-35535238 TGTTTGTAGACTCATGGGCTGGG + Intergenic
1082188416 11:49211824-49211846 TGTATTTATTCCCAGGGCTTTGG - Intergenic
1084511072 11:69604378-69604400 TCTAATTATACCCACGGCCTTGG + Intergenic
1086678106 11:89634879-89634901 TGTATTTATTCCCAGGGCTTTGG + Intergenic
1089987391 11:122826561-122826583 TGTGTCTTTGCCCATGGGCTGGG - Intergenic
1093795666 12:23307648-23307670 TGATTTTATACACATGGGATTGG - Intergenic
1093911427 12:24751938-24751960 GGTATTTAAACCCATGGGAATGG - Intergenic
1095162993 12:38938291-38938313 TGTATTTTTCCCCATTGTCTAGG + Intergenic
1095846549 12:46751805-46751827 TGTATTTATTTCCTTGGGCTTGG + Intergenic
1103214471 12:119190932-119190954 TGTATTTAAACCCATTTGGTGGG - Intronic
1103484467 12:121273693-121273715 GGTATTTATACTCATGGGTGAGG - Intronic
1106662049 13:31810047-31810069 TGTGTTTGTCCCCTTGGGCTTGG + Intergenic
1107507913 13:41053858-41053880 TGTATTTATACAAATGAGTTTGG - Intronic
1108380040 13:49846607-49846629 TGTATTAAGACCCCTGGGCCGGG - Intergenic
1115725488 14:36211216-36211238 TGTATATCTATCCATGGGGTAGG - Intergenic
1117426467 14:55603620-55603642 TCTATTTATACCCATTTGTTTGG + Intronic
1118562174 14:67097808-67097830 TGTATTTCTTCCCATGGGTGTGG - Intronic
1120264171 14:82228065-82228087 TGTATTTATACACATAGGCTTGG + Intergenic
1120579344 14:86227115-86227137 TGTATTTACAACCATGGGGAAGG - Intergenic
1126208718 15:46075739-46075761 TTTATTTCTTCCCATGGGCATGG + Intergenic
1126600058 15:50419044-50419066 TGGACTTATACCCCTGTGCTTGG + Intergenic
1127101963 15:55575808-55575830 GGTATTAATACCTCTGGGCTTGG - Intronic
1128262893 15:66244867-66244889 TGTCTTTATACCCAGGGTCGTGG - Intronic
1132110251 15:99097538-99097560 TGTATTTAAAGCCATGAGATTGG + Intergenic
1133855028 16:9541672-9541694 TGTAGTTTGACCCATGTGCTAGG + Intergenic
1136641096 16:31565900-31565922 TTTATTTAAGCCCATGGGTTTGG - Intergenic
1136663877 16:31791420-31791442 TTTATTTAAGCCCATGGGTTTGG + Intronic
1138917870 16:61489477-61489499 GGTATTTATACCAAGTGGCTGGG + Intergenic
1139405154 16:66712172-66712194 TGTATTGAAGACCATGGGCTAGG + Intergenic
1140686617 16:77439836-77439858 TGTATTTCTAACCATGTTCTGGG - Intergenic
1140982961 16:80128240-80128262 TCCTTTTATTCCCATGGGCTTGG + Intergenic
1141004809 16:80342066-80342088 TTTCTTTATGCCCATGTGCTTGG - Intergenic
1142857896 17:2742654-2742676 AGTATTTACAGCCATGGGATGGG - Intergenic
1143641160 17:8198478-8198500 CGTATTTAAAACCACGGGCTGGG + Intergenic
1147438257 17:40431159-40431181 TATATTTACACCCAAGTGCTGGG - Intergenic
1147680049 17:42237187-42237209 TCTGGATATACCCATGGGCTTGG + Intronic
1148538716 17:48462706-48462728 TGAATTTCTACCTAAGGGCTAGG - Intergenic
1155590095 18:27418113-27418135 TGTATATATACCCAAGGGAATGG - Intergenic
1156325879 18:36074809-36074831 TGTATCAAAGCCCATGGGCTGGG - Intergenic
1157036373 18:43979814-43979836 AGAATTTATACCCTTGGGATTGG - Intergenic
1157968178 18:52233755-52233777 TCTGTTTTGACCCATGGGCTAGG - Intergenic
1163704656 19:18805092-18805114 GGTATTTTTGCCCATGGGTTGGG - Intergenic
1165473179 19:36014977-36014999 TGTCTTGAAACCCATGGACTCGG + Exonic
1165754225 19:38282733-38282755 TGTCTTTGGAGCCATGGGCTGGG + Intronic
1166130101 19:40740892-40740914 TGTATTTGGACACGTGGGCTGGG + Exonic
1167251890 19:48403542-48403564 AGTATTTAAACTCATGGGCCTGG + Intronic
1167308136 19:48720468-48720490 GGTATTTATAGCCACGGCCTTGG - Intergenic
1167601443 19:50457346-50457368 TGGGTTTATGGCCATGGGCTGGG - Intronic
925784117 2:7411941-7411963 TGTAATTGTTCCCAGGGGCTGGG - Intergenic
931962063 2:67493153-67493175 TGTATTTTTACTCATGGACCTGG - Intergenic
932021630 2:68093755-68093777 TGCATTTATACCGCTGTGCTGGG - Intronic
933280865 2:80331342-80331364 AGTATTTAAACCCATACGCTTGG - Intronic
935186120 2:100734539-100734561 TGTGTTTATCCTCCTGGGCTTGG - Intergenic
935402475 2:102674723-102674745 TGTATTTATTCGCATGAGCCAGG - Intronic
935545275 2:104394614-104394636 TGGATTTATACCCGTGTGCTTGG - Intergenic
935729903 2:106056600-106056622 TGTATTGATACAGAAGGGCTGGG - Intergenic
935744087 2:106175834-106175856 TGTATTTATACCCATGGGCTTGG - Intronic
937702223 2:124876478-124876500 TGCAGTTATAGCCATGGGCTAGG + Intronic
940753058 2:157649432-157649454 TATATTTATAACCATGAGGTAGG - Intergenic
943495198 2:188611301-188611323 TGTATTCATACCCTAGGGTTTGG - Intergenic
947813174 2:233017610-233017632 TCTATTTCTATCCATGGCCTGGG - Intergenic
1171375914 20:24694082-24694104 TGGATTTGTACCCAGGGGGTTGG + Intergenic
1173523687 20:43716707-43716729 AGTATTAATAGCCATGGGGTTGG + Intergenic
1176741396 21:10606746-10606768 TGAATTAACACCCATGGACTGGG - Intergenic
1181746856 22:24961293-24961315 TGTATTAAAACCCAAGGGCCAGG - Intronic
949335656 3:2972032-2972054 TGTAATTATACCACTGTGCTTGG - Intronic
950119826 3:10474419-10474441 GGTATTTAAAGCCATGGGATGGG + Intronic
951172361 3:19556685-19556707 TGTATTAATGCCTGTGGGCTGGG + Intergenic
954859837 3:53678378-53678400 TGAATTTATAGACCTGGGCTGGG - Intronic
957250930 3:77770189-77770211 TTTATTTATACACGTGGGCATGG - Intergenic
962562129 3:136617441-136617463 TGGACTTATACCCATGTGCCTGG + Intronic
962823887 3:139081283-139081305 TGTAAGTATGCCCCTGGGCTTGG + Intronic
963162341 3:142163698-142163720 TGAAATTACACCCATTGGCTGGG + Intronic
965959866 3:174416376-174416398 TGTATTTAGACCTATGGGAGTGG - Intergenic
966089790 3:176119074-176119096 TGTATCTATAGCCACGTGCTTGG - Intergenic
966274381 3:178147173-178147195 TGTATTTATACCAAGGGAATTGG + Intergenic
967242338 3:187452571-187452593 TGAATTTATACCTATGAGGTGGG - Intergenic
968187378 3:196642565-196642587 TGGATTGATTCTCATGGGCTTGG + Intronic
969334216 4:6497591-6497613 TGTTATTATAACCCTGGGCTAGG + Intronic
973848135 4:54934015-54934037 GGTATTTAAAACCATGGGATTGG - Intergenic
973866570 4:55120113-55120135 TGTGTTTTTTCCCAAGGGCTGGG + Intronic
974482960 4:62470210-62470232 AGTACTTATACACATGGGCACGG + Intergenic
976306278 4:83562977-83562999 TGAATTTATACACATGAGGTGGG + Intronic
978701180 4:111648134-111648156 TATATTTTTACCCCTAGGCTAGG + Intergenic
978965821 4:114740147-114740169 TGTATTTAGGTACATGGGCTCGG - Intergenic
979123848 4:116941335-116941357 TTTATTTATACCCATGTCATTGG + Intergenic
979393040 4:120149741-120149763 TGTCTTTATACCCAAGCACTGGG - Intergenic
982211012 4:153036396-153036418 TGTATTTATTCCCATTGCCACGG - Intergenic
988144321 5:27285055-27285077 TCTATTTATACACATGGCATTGG + Intergenic
988300868 5:29424479-29424501 TGTATTAAAATCCATGGGCCAGG - Intergenic
989555618 5:42791375-42791397 TTTATTAATACCCATGGGGATGG - Intronic
989812776 5:45697011-45697033 TGTATTGATACGAATGGCCTTGG - Intergenic
990242994 5:53834406-53834428 TGTATTTATTGCCATTGTCTTGG + Intergenic
990257950 5:53991045-53991067 TGGAATTATACCCATGGGGTGGG - Intronic
990733501 5:58834781-58834803 TGTGGTCATATCCATGGGCTGGG + Intronic
991443183 5:66672788-66672810 GGGATTTATACCCAGGGGCAGGG + Intronic
994595517 5:101828011-101828033 TGTATTTTTACTCATTGACTAGG + Intergenic
994995591 5:107058377-107058399 TGTTTCTACACACATGGGCTTGG + Intergenic
996334988 5:122373841-122373863 TGGATTTACACCCAAGGGGTGGG - Intronic
999883974 5:155899540-155899562 TGTGTTTCTTCCCATGTGCTGGG + Intronic
1000097191 5:157981993-157982015 TGTCTTTCTACCCATGGACGTGG + Intergenic
1002912845 6:1504270-1504292 TGTATTGAAGCCTATGGGCTGGG + Intergenic
1003976537 6:11350322-11350344 TGTATGTATACCCTTGAGCATGG - Intronic
1004756079 6:18611825-18611847 TATATTTATACAAATAGGCTAGG - Intergenic
1007391768 6:41553505-41553527 TGGATGGATACCCATGGACTGGG + Intronic
1009004102 6:57760384-57760406 TGTATTAAAATCCATGGGCCAGG - Intergenic
1009606515 6:65876290-65876312 TGTATTTACACCCATTCACTGGG - Intergenic
1024331129 7:48156385-48156407 GGTATTTAAAGCCATGAGCTTGG + Intergenic
1026279685 7:68911130-68911152 TGTGTATAAACCCATGGGATTGG + Intergenic
1030085422 7:105811630-105811652 TGCATTTATAGCCATGGGGCTGG + Intronic
1031445217 7:121845473-121845495 TTTATTAATACCCAGGTGCTTGG - Intergenic
1033790869 7:144791043-144791065 AGTATGTAAACCCATGGGGTAGG + Intronic
1034039403 7:147861351-147861373 GGCATTTATAAGCATGGGCTAGG - Intronic
1035042490 7:155939920-155939942 TCTAATTATACTCATGTGCTGGG + Intergenic
1037366459 8:18127707-18127729 TGTATTTATACCAATCGCTTAGG + Intergenic
1042824700 8:72968384-72968406 TGTATATATACATATGTGCTGGG - Intergenic
1042940565 8:74103168-74103190 TGTTTTTCTACCCTTGGGCGAGG + Intergenic
1046201002 8:110927413-110927435 TGTATTTCTAGCCATGGGAGAGG - Intergenic
1046849519 8:118956350-118956372 TGTATTTATGGCCATGAGCAGGG - Intergenic
1047408312 8:124603560-124603582 TTTATTTTTACCCTTGGGCATGG + Intronic
1050096230 9:2069717-2069739 TGTTTTTATGCCCATGGAGTGGG + Intronic
1050455988 9:5834669-5834691 TATAGTTATGACCATGGGCTAGG - Intergenic
1053160136 9:35808457-35808479 TCTATTTATATCCATGGGGATGG - Intronic
1053205834 9:36185936-36185958 TGTATATATATCCATATGCTGGG - Intergenic
1054337881 9:63823983-63824005 TGTATTTATACGCATTTTCTTGG - Intergenic
1058322082 9:103645225-103645247 TGTGTTCATACCCATGGCCTTGG - Intergenic
1060200435 9:121649175-121649197 TGCATTTCTACCCTTGGGATGGG - Intronic
1061263345 9:129491831-129491853 TGTGTTCATACCCATGAGCATGG - Intergenic
1202784648 9_KI270718v1_random:37282-37304 TGTATTTATACGCATTTTCTTGG + Intergenic
1185522340 X:750304-750326 TGTATTCATTGCCAAGGGCTGGG + Intergenic
1187451152 X:19397666-19397688 TGTGTTTCCACCCATTGGCTAGG - Intronic
1188038570 X:25345631-25345653 TGAATATATACACATAGGCTTGG + Intergenic
1191743321 X:64459223-64459245 TTTATTTCTACCTATGAGCTTGG + Intergenic
1192792359 X:74394990-74395012 TGTAATAATAGCCATGGGCTGGG - Intergenic
1194663440 X:96651325-96651347 TGTATATATCACCATAGGCTGGG - Intergenic
1195859599 X:109368924-109368946 TGTATGTACAAGCATGGGCTTGG - Intergenic
1197270267 X:124417605-124417627 TGTATTTAAAACCATGAGATGGG - Intronic