ID: 935745925

View in Genome Browser
Species Human (GRCh38)
Location 2:106190279-106190301
Sequence AGATTATACCACATCTATAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 130}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935745925 Original CRISPR AGATTATACCACATCTATAT AGG Intronic
908926968 1:69266960-69266982 AGATTGTACCACAGCAATATTGG - Intergenic
909389196 1:75098987-75099009 AAATAATACCACATATATTTAGG - Intergenic
909888085 1:80967490-80967512 AGATTATACAACCTCTTCATGGG - Intergenic
910044262 1:82892316-82892338 AAATTCTGCCACAACTATATGGG + Intergenic
912042174 1:105405413-105405435 AGACTATAACGCATTTATATAGG + Intergenic
912645147 1:111385169-111385191 AGATCTCAACACATCTATATGGG - Intergenic
913402067 1:118447802-118447824 ATATTATGCCACTTATATATTGG - Intergenic
914332876 1:146688850-146688872 AGATGAAACCACATCTCTGTGGG + Intergenic
915048159 1:153037229-153037251 AGAATATACAACATCTCTACAGG + Intergenic
918986365 1:191632999-191633021 AGATTATACCACAGATCTAGAGG + Intergenic
924554906 1:245109881-245109903 AGCTGATAGCACATCTATTTAGG - Intronic
1065695416 10:28375309-28375331 ATATTATTGCACATCTAGATGGG - Intergenic
1069329457 10:67274503-67274525 AGATTATACCACATCTCTTTTGG + Intronic
1070641214 10:78171683-78171705 AGCTTATACCACTTCTCTAGAGG - Intergenic
1074627389 10:115206511-115206533 AGCTAATATCATATCTATATAGG + Intronic
1081389494 11:42512940-42512962 AGACTTTACCACCACTATATTGG - Intergenic
1085380028 11:76107538-76107560 ACATTATAACATATCTATTTTGG + Intronic
1087223666 11:95573853-95573875 AGATAATATCACATTTATAATGG + Intergenic
1094312606 12:29101126-29101148 TGATGATAACACATCAATATCGG - Intergenic
1095389510 12:41689256-41689278 AGATATTATCACATCTATTTAGG + Intergenic
1095826822 12:46538501-46538523 CCATTTTATCACATCTATATTGG + Intergenic
1099474892 12:83096202-83096224 TGATAATACCACATATATTTTGG - Intronic
1100143749 12:91651622-91651644 GGATTATCCCACATTTATCTGGG + Intergenic
1104599762 12:130144768-130144790 AGAAAATGCTACATCTATATGGG + Intergenic
1104737855 12:131149930-131149952 AGAGTATACCACAGATATACAGG + Intergenic
1106347011 13:28888775-28888797 AGATTTTACAAGATCAATATGGG - Intronic
1107254279 13:38404909-38404931 AGATTATAGCACATCAAAAAAGG - Intergenic
1107791893 13:44010900-44010922 AGATTTTTCCTCATATATATTGG + Intergenic
1109672718 13:65630814-65630836 ATATTACACCAAATTTATATTGG + Intergenic
1110631730 13:77715630-77715652 AGATTCTACCACATACCTATTGG - Intronic
1111425911 13:88082140-88082162 AGATGAAACCACACCTATTTAGG + Intergenic
1111449890 13:88401241-88401263 AAATTATAAGACAACTATATGGG + Intergenic
1115194882 14:30786488-30786510 AGATAATACATCATCTAAATGGG + Intergenic
1115971507 14:38949651-38949673 GGCTTATAACACATGTATATAGG + Intergenic
1117164377 14:53019050-53019072 AGATTCTACCACATTTAGAGAGG + Intergenic
1117469862 14:56032373-56032395 AAATTATAACATAACTATATTGG + Intergenic
1119264603 14:73256557-73256579 AGATTTTACCACATATCTGTTGG + Intronic
1119417461 14:74482777-74482799 AGATAATATCACCTCTACATAGG + Intronic
1119684365 14:76619778-76619800 AGACTTTACCACATATATAATGG - Intergenic
1120239182 14:81929841-81929863 AGATTATACTACTGCTCTATTGG + Intergenic
1124660305 15:31543805-31543827 AGATTTTAACACATCTCTATCGG + Intronic
1125192444 15:37009339-37009361 AGATGAGACCAAATTTATATTGG - Intronic
1128191513 15:65704289-65704311 TGATTATACCAAAATTATATTGG + Intronic
1135387088 16:22051995-22052017 AAATTATTCCACATATATATAGG - Intronic
1140000739 16:71022394-71022416 AGATGAAACCACATCTCTGTGGG - Intronic
1140681210 16:77386537-77386559 AGCTTATGCCACATCTTTATGGG - Intronic
1142968559 17:3596148-3596170 AGATCATACCACGTCTCTGTGGG - Intronic
1143813494 17:9491728-9491750 AGATTATACAACATGTAAAGTGG - Intronic
1148985137 17:51614042-51614064 AGAAAATACCACCTCTATTTTGG + Intergenic
1149830348 17:59866421-59866443 TGTTTAAACCACTTCTATATTGG + Intronic
1152636015 17:81430849-81430871 CGTTTCTACCACATCTATGTGGG + Intronic
1159872577 18:73775235-73775257 AAATCATACCATATCTATGTGGG + Intergenic
1160532427 18:79573343-79573365 AGAATATCCCACATGTATTTAGG + Intergenic
1164959861 19:32418639-32418661 AATTTATACCATTTCTATATTGG + Intronic
925937726 2:8782603-8782625 AAATTATACCAACTCTACATAGG + Intronic
926968952 2:18446881-18446903 AGATTAGATAACATCTTTATTGG - Intergenic
927563501 2:24090617-24090639 TGATTATACAAAATCAATATTGG + Intronic
928583585 2:32733848-32733870 AGATAAAACTACATCTGTATTGG + Exonic
928945124 2:36765220-36765242 AGATTATTTCACATCCATAGAGG + Intronic
931568479 2:63642210-63642232 AAATTATACCACATCAAGATAGG - Intronic
935459160 2:103308047-103308069 AGATTATAATACACGTATATGGG - Intergenic
935514452 2:104019412-104019434 AGATTCTTCCACATCTTTATGGG + Intergenic
935745925 2:106190279-106190301 AGATTATACCACATCTATATAGG + Intronic
938196118 2:129330213-129330235 AAAATATATCATATCTATATTGG + Intergenic
939259392 2:139787866-139787888 AGATAATACAACATGAATATTGG - Intergenic
940123572 2:150295916-150295938 TGATTCTACCACAATTATATAGG + Intergenic
941218929 2:162749765-162749787 AGAGTATAGCACGTCTCTATGGG + Intronic
943398873 2:187378824-187378846 ACATTATAAATCATCTATATTGG + Intronic
943620456 2:190142413-190142435 ACATTATACCTCATAAATATTGG - Intronic
946097689 2:217289877-217289899 AGCTTATTCCCCATCTATCTTGG + Intronic
946646487 2:221842058-221842080 AAATTCTACCAAATCTTTATAGG - Intergenic
947409742 2:229824047-229824069 AGTTTATAACACGTATATATAGG + Intronic
1177937905 21:27372612-27372634 AGATTCTACCACAATTAGATTGG + Intergenic
1178203480 21:30436318-30436340 AGATTATTCCTCATCTATCATGG + Intergenic
953106417 3:39884974-39884996 AATTTATACCACCTCTATAGAGG - Intronic
953579287 3:44138953-44138975 AGATTATTCCACATAAATACTGG + Intergenic
956369568 3:68543919-68543941 AGGTTAGACCACATCTGTGTAGG - Intronic
956838920 3:73118944-73118966 AGTTTATAGCACTTCTTTATAGG + Intergenic
956896872 3:73669993-73670015 AGTTTATATAACATATATATAGG - Intergenic
956907773 3:73784830-73784852 AGATTAAACCACATCTGTTTGGG - Intergenic
960322544 3:116254093-116254115 AGAGTATTCCACATATATTTAGG - Intronic
962473807 3:135738464-135738486 AAATTATGCTACATCTATAATGG - Intergenic
971528938 4:27660086-27660108 AAATTATACCACATCTAGTGTGG - Intergenic
972524698 4:39897036-39897058 AGATAAGACCACATGTATTTTGG - Intronic
972814998 4:42634831-42634853 AGATTATAACACTTCTACATGGG + Intronic
976020391 4:80616787-80616809 AGAAAATAGAACATCTATATAGG + Intronic
977494674 4:97760015-97760037 AGATTATACTATAACTATATTGG - Intronic
978752402 4:112265294-112265316 CTATTGTATCACATCTATATGGG - Intronic
979147237 4:117259648-117259670 AGATTATACGAAATTTATAAAGG + Intergenic
982269580 4:153572686-153572708 ATATTTTACCCCATATATATAGG - Intronic
983385190 4:167052822-167052844 AGATTAGACAATATCAATATTGG - Intronic
983539372 4:168892032-168892054 ATATTTTACCAAATCTATTTAGG - Intronic
985034957 4:185829204-185829226 ATATTAGACCACATGTATAGAGG - Intronic
985363003 4:189195250-189195272 AGATTAGACTACATCTATATAGG + Intergenic
986381547 5:7191544-7191566 ACATCATCCCACATCTATAATGG - Intergenic
987480739 5:18454181-18454203 AGATTATATCAGGACTATATCGG + Intergenic
988339729 5:29955224-29955246 AGATTAAGCCACATATATTTTGG + Intergenic
988453108 5:31362953-31362975 AAATTAAACCATATCTATTTAGG - Intergenic
988652680 5:33170152-33170174 ATATTACACCACATCTTCATAGG + Intergenic
991441149 5:66650825-66650847 AGGTTTTACCACATGTATTTGGG - Intronic
991978433 5:72206242-72206264 AGTTTATAAAACATCCATATAGG + Exonic
994489662 5:100424856-100424878 AGATTTAATCACCTCTATATAGG - Intergenic
994950279 5:106452885-106452907 AGATTAAAGCACATCTATTTGGG + Intergenic
996582436 5:125046904-125046926 AGATTCTACCAAATGTATCTAGG - Intergenic
998785360 5:145702839-145702861 AGAAGATACCACTTCTATGTGGG + Intronic
1002210526 5:177596291-177596313 AGATTATACAACAAGTAAATTGG + Intergenic
1003134653 6:3425125-3425147 TTATTATACCAAATTTATATAGG + Intronic
1003467381 6:6393655-6393677 ACATTATACTACATCTAGAGAGG - Intergenic
1008028308 6:46664033-46664055 AGATAATATCACATATTTATTGG - Intronic
1010958475 6:82118381-82118403 AGATTATACCACAACACTTTTGG - Intergenic
1011092264 6:83617141-83617163 AAATTATCTCACATATATATCGG - Intronic
1012693126 6:102341386-102341408 AGATTATAATACAAATATATTGG + Intergenic
1014081453 6:117291378-117291400 TGGTTATACCAAATCTATTTAGG - Intronic
1014989662 6:128057842-128057864 AAATCATAATACATCTATATAGG + Intronic
1016011238 6:139139336-139139358 ATATTTTACTACATCTGTATGGG - Intronic
1017288018 6:152700992-152701014 GTATTATTCCACAACTATATAGG - Intronic
1018277407 6:162147375-162147397 GGATCATACCACGTCTATGTTGG + Intronic
1019853952 7:3585801-3585823 AAATTATACCACATGTTTAGAGG - Intronic
1022027511 7:26462456-26462478 AGATTATGACACATGTTTATTGG - Intergenic
1030260563 7:107559862-107559884 AAATCATAGCACATGTATATTGG + Intronic
1031111866 7:117620433-117620455 GGATTATTCCACATCCTTATAGG + Intronic
1031881233 7:127200771-127200793 AGATCATACCACATTAAGATGGG - Intronic
1032899030 7:136285415-136285437 TTATTATCCTACATCTATATTGG - Intergenic
1034255383 7:149722044-149722066 AGATGAAACCACAGCTAAATGGG - Intronic
1039306049 8:36264223-36264245 AGATTACACCACTTCTAATTAGG - Intergenic
1039643399 8:39249959-39249981 AGAAAATACCATATCTATAGAGG - Intronic
1040605822 8:48930216-48930238 ATTTTATACCGCAACTATATGGG + Intergenic
1041150845 8:54932173-54932195 AGATTATAACATATATATTTAGG - Intergenic
1043333377 8:79144483-79144505 AGATTTTTCCACATATCTATTGG + Intergenic
1044133947 8:88560724-88560746 AGATTTGACCACTCCTATATGGG + Intergenic
1044448542 8:92306701-92306723 AAATTATAATACAACTATATTGG - Intergenic
1048665074 8:136652006-136652028 ATATTTTACAACATCTTTATAGG + Intergenic
1051295745 9:15593823-15593845 AGATTATACCTTGTTTATATAGG - Intronic
1056449200 9:86699137-86699159 AGATTTAACCACATGTTTATGGG + Intergenic
1057838434 9:98465628-98465650 AAATGATACCACATCTATAATGG + Intronic
1058244963 9:102611567-102611589 AGGCTATACCACATCTTTAGTGG + Intergenic
1058477943 9:105359520-105359542 AAATTAGATCACATCTATAAAGG + Intronic
1058569731 9:106328148-106328170 AAATTATATCATATATATATAGG - Intergenic
1059782954 9:117549187-117549209 GTATAATACCACATCTATCTTGG + Intergenic
1062706582 9:137947814-137947836 AAATGATACCATACCTATATGGG - Intronic
1189700462 X:43713496-43713518 CTAGTATTCCACATCTATATGGG - Intronic
1194527837 X:95001091-95001113 AGATTTTACCACATTTCTCTTGG - Intergenic
1196703357 X:118695631-118695653 ACATAATTCCACATCTATAATGG - Intergenic
1197023710 X:121721140-121721162 AAATTATACCAAATATAAATGGG - Intergenic