ID: 935751987

View in Genome Browser
Species Human (GRCh38)
Location 2:106243649-106243671
Sequence CATGTGGATTCAGTGAGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935751987_935751991 -5 Left 935751987 2:106243649-106243671 CCAGCACTCACTGAATCCACATG No data
Right 935751991 2:106243667-106243689 ACATGTTGCACATAATAGGAGGG No data
935751987_935751990 -6 Left 935751987 2:106243649-106243671 CCAGCACTCACTGAATCCACATG No data
Right 935751990 2:106243666-106243688 CACATGTTGCACATAATAGGAGG No data
935751987_935751988 -9 Left 935751987 2:106243649-106243671 CCAGCACTCACTGAATCCACATG No data
Right 935751988 2:106243663-106243685 ATCCACATGTTGCACATAATAGG No data
935751987_935751992 3 Left 935751987 2:106243649-106243671 CCAGCACTCACTGAATCCACATG No data
Right 935751992 2:106243675-106243697 CACATAATAGGAGGGAGTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935751987 Original CRISPR CATGTGGATTCAGTGAGTGC TGG (reversed) Intergenic
No off target data available for this crispr