ID: 935751988

View in Genome Browser
Species Human (GRCh38)
Location 2:106243663-106243685
Sequence ATCCACATGTTGCACATAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935751987_935751988 -9 Left 935751987 2:106243649-106243671 CCAGCACTCACTGAATCCACATG No data
Right 935751988 2:106243663-106243685 ATCCACATGTTGCACATAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935751988 Original CRISPR ATCCACATGTTGCACATAAT AGG Intergenic
No off target data available for this crispr