ID: 935753918

View in Genome Browser
Species Human (GRCh38)
Location 2:106262375-106262397
Sequence TCCTGATGGCTCCCCAGTAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935753918_935753923 -5 Left 935753918 2:106262375-106262397 CCCGTACTGGGGAGCCATCAGGA No data
Right 935753923 2:106262393-106262415 CAGGAGCTTTTAAGTCAGGGAGG No data
935753918_935753922 -8 Left 935753918 2:106262375-106262397 CCCGTACTGGGGAGCCATCAGGA No data
Right 935753922 2:106262390-106262412 CATCAGGAGCTTTTAAGTCAGGG No data
935753918_935753921 -9 Left 935753918 2:106262375-106262397 CCCGTACTGGGGAGCCATCAGGA No data
Right 935753921 2:106262389-106262411 CCATCAGGAGCTTTTAAGTCAGG No data
935753918_935753924 -4 Left 935753918 2:106262375-106262397 CCCGTACTGGGGAGCCATCAGGA No data
Right 935753924 2:106262394-106262416 AGGAGCTTTTAAGTCAGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935753918 Original CRISPR TCCTGATGGCTCCCCAGTAC GGG (reversed) Intergenic
No off target data available for this crispr