ID: 935756973

View in Genome Browser
Species Human (GRCh38)
Location 2:106283867-106283889
Sequence CCCTGCCTCCCAGGTAGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935756973_935756978 -5 Left 935756973 2:106283867-106283889 CCAGTTCTACCTGGGAGGCAGGG No data
Right 935756978 2:106283885-106283907 CAGGGAAAGGTGCCCAGAGGAGG No data
935756973_935756977 -8 Left 935756973 2:106283867-106283889 CCAGTTCTACCTGGGAGGCAGGG No data
Right 935756977 2:106283882-106283904 AGGCAGGGAAAGGTGCCCAGAGG No data
935756973_935756981 19 Left 935756973 2:106283867-106283889 CCAGTTCTACCTGGGAGGCAGGG No data
Right 935756981 2:106283909-106283931 GATGCCAAGCAAACTCCCACAGG No data
935756973_935756984 29 Left 935756973 2:106283867-106283889 CCAGTTCTACCTGGGAGGCAGGG No data
Right 935756984 2:106283919-106283941 AAACTCCCACAGGAGGAGACAGG No data
935756973_935756982 22 Left 935756973 2:106283867-106283889 CCAGTTCTACCTGGGAGGCAGGG No data
Right 935756982 2:106283912-106283934 GCCAAGCAAACTCCCACAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935756973 Original CRISPR CCCTGCCTCCCAGGTAGAAC TGG (reversed) Intergenic