ID: 935756976

View in Genome Browser
Species Human (GRCh38)
Location 2:106283876-106283898
Sequence GGCACCTTTCCCTGCCTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935756976_935756981 10 Left 935756976 2:106283876-106283898 CCTGGGAGGCAGGGAAAGGTGCC No data
Right 935756981 2:106283909-106283931 GATGCCAAGCAAACTCCCACAGG No data
935756976_935756982 13 Left 935756976 2:106283876-106283898 CCTGGGAGGCAGGGAAAGGTGCC No data
Right 935756982 2:106283912-106283934 GCCAAGCAAACTCCCACAGGAGG No data
935756976_935756984 20 Left 935756976 2:106283876-106283898 CCTGGGAGGCAGGGAAAGGTGCC No data
Right 935756984 2:106283919-106283941 AAACTCCCACAGGAGGAGACAGG No data
935756976_935756988 26 Left 935756976 2:106283876-106283898 CCTGGGAGGCAGGGAAAGGTGCC No data
Right 935756988 2:106283925-106283947 CCACAGGAGGAGACAGGAGGAGG No data
935756976_935756985 23 Left 935756976 2:106283876-106283898 CCTGGGAGGCAGGGAAAGGTGCC No data
Right 935756985 2:106283922-106283944 CTCCCACAGGAGGAGACAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935756976 Original CRISPR GGCACCTTTCCCTGCCTCCC AGG (reversed) Intergenic