ID: 935756979

View in Genome Browser
Species Human (GRCh38)
Location 2:106283897-106283919
Sequence TGCTTGGCATCACCTCCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935756979_935756984 -1 Left 935756979 2:106283897-106283919 CCCAGAGGAGGTGATGCCAAGCA No data
Right 935756984 2:106283919-106283941 AAACTCCCACAGGAGGAGACAGG No data
935756979_935756982 -8 Left 935756979 2:106283897-106283919 CCCAGAGGAGGTGATGCCAAGCA No data
Right 935756982 2:106283912-106283934 GCCAAGCAAACTCCCACAGGAGG No data
935756979_935756988 5 Left 935756979 2:106283897-106283919 CCCAGAGGAGGTGATGCCAAGCA No data
Right 935756988 2:106283925-106283947 CCACAGGAGGAGACAGGAGGAGG No data
935756979_935756990 19 Left 935756979 2:106283897-106283919 CCCAGAGGAGGTGATGCCAAGCA No data
Right 935756990 2:106283939-106283961 AGGAGGAGGTGCTCATGAGAGGG No data
935756979_935756989 18 Left 935756979 2:106283897-106283919 CCCAGAGGAGGTGATGCCAAGCA No data
Right 935756989 2:106283938-106283960 CAGGAGGAGGTGCTCATGAGAGG No data
935756979_935756985 2 Left 935756979 2:106283897-106283919 CCCAGAGGAGGTGATGCCAAGCA No data
Right 935756985 2:106283922-106283944 CTCCCACAGGAGGAGACAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935756979 Original CRISPR TGCTTGGCATCACCTCCTCT GGG (reversed) Intergenic