ID: 935756980

View in Genome Browser
Species Human (GRCh38)
Location 2:106283898-106283920
Sequence TTGCTTGGCATCACCTCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935756980_935756985 1 Left 935756980 2:106283898-106283920 CCAGAGGAGGTGATGCCAAGCAA No data
Right 935756985 2:106283922-106283944 CTCCCACAGGAGGAGACAGGAGG No data
935756980_935756982 -9 Left 935756980 2:106283898-106283920 CCAGAGGAGGTGATGCCAAGCAA No data
Right 935756982 2:106283912-106283934 GCCAAGCAAACTCCCACAGGAGG No data
935756980_935756989 17 Left 935756980 2:106283898-106283920 CCAGAGGAGGTGATGCCAAGCAA No data
Right 935756989 2:106283938-106283960 CAGGAGGAGGTGCTCATGAGAGG No data
935756980_935756990 18 Left 935756980 2:106283898-106283920 CCAGAGGAGGTGATGCCAAGCAA No data
Right 935756990 2:106283939-106283961 AGGAGGAGGTGCTCATGAGAGGG No data
935756980_935756984 -2 Left 935756980 2:106283898-106283920 CCAGAGGAGGTGATGCCAAGCAA No data
Right 935756984 2:106283919-106283941 AAACTCCCACAGGAGGAGACAGG No data
935756980_935756988 4 Left 935756980 2:106283898-106283920 CCAGAGGAGGTGATGCCAAGCAA No data
Right 935756988 2:106283925-106283947 CCACAGGAGGAGACAGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935756980 Original CRISPR TTGCTTGGCATCACCTCCTC TGG (reversed) Intergenic