ID: 935756981

View in Genome Browser
Species Human (GRCh38)
Location 2:106283909-106283931
Sequence GATGCCAAGCAAACTCCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935756976_935756981 10 Left 935756976 2:106283876-106283898 CCTGGGAGGCAGGGAAAGGTGCC No data
Right 935756981 2:106283909-106283931 GATGCCAAGCAAACTCCCACAGG No data
935756973_935756981 19 Left 935756973 2:106283867-106283889 CCAGTTCTACCTGGGAGGCAGGG No data
Right 935756981 2:106283909-106283931 GATGCCAAGCAAACTCCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935756981 Original CRISPR GATGCCAAGCAAACTCCCAC AGG Intergenic