ID: 935756982

View in Genome Browser
Species Human (GRCh38)
Location 2:106283912-106283934
Sequence GCCAAGCAAACTCCCACAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935756979_935756982 -8 Left 935756979 2:106283897-106283919 CCCAGAGGAGGTGATGCCAAGCA No data
Right 935756982 2:106283912-106283934 GCCAAGCAAACTCCCACAGGAGG No data
935756973_935756982 22 Left 935756973 2:106283867-106283889 CCAGTTCTACCTGGGAGGCAGGG No data
Right 935756982 2:106283912-106283934 GCCAAGCAAACTCCCACAGGAGG No data
935756980_935756982 -9 Left 935756980 2:106283898-106283920 CCAGAGGAGGTGATGCCAAGCAA No data
Right 935756982 2:106283912-106283934 GCCAAGCAAACTCCCACAGGAGG No data
935756976_935756982 13 Left 935756976 2:106283876-106283898 CCTGGGAGGCAGGGAAAGGTGCC No data
Right 935756982 2:106283912-106283934 GCCAAGCAAACTCCCACAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935756982 Original CRISPR GCCAAGCAAACTCCCACAGG AGG Intergenic