ID: 935756984

View in Genome Browser
Species Human (GRCh38)
Location 2:106283919-106283941
Sequence AAACTCCCACAGGAGGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935756973_935756984 29 Left 935756973 2:106283867-106283889 CCAGTTCTACCTGGGAGGCAGGG No data
Right 935756984 2:106283919-106283941 AAACTCCCACAGGAGGAGACAGG No data
935756980_935756984 -2 Left 935756980 2:106283898-106283920 CCAGAGGAGGTGATGCCAAGCAA No data
Right 935756984 2:106283919-106283941 AAACTCCCACAGGAGGAGACAGG No data
935756976_935756984 20 Left 935756976 2:106283876-106283898 CCTGGGAGGCAGGGAAAGGTGCC No data
Right 935756984 2:106283919-106283941 AAACTCCCACAGGAGGAGACAGG No data
935756979_935756984 -1 Left 935756979 2:106283897-106283919 CCCAGAGGAGGTGATGCCAAGCA No data
Right 935756984 2:106283919-106283941 AAACTCCCACAGGAGGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935756984 Original CRISPR AAACTCCCACAGGAGGAGAC AGG Intergenic
No off target data available for this crispr